Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Expression vector resisting porcine circovirus type 2 (PCV2) and transgenic pig, and construction methods thereof

A technology of porcine circovirus and its construction method, which is applied in the field of transgenic pigs resistant to porcine circovirus type 2 and its construction, which can solve the problems of undetected whether the siRNA is correctly expressed, unfavorable development of safety tests of transgenic organisms, and slow genetic progress, etc. , to achieve the effect of improving transgenic efficiency, facilitating detection, and inhibiting infection

Inactive Publication Date: 2013-12-25
SOUTH CHINA AGRI UNIV
View PDF3 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, conventional breeding technology has made remarkable achievements in realizing the utilization of pig heterosis, performance measurement, genetic evaluation and breeding of superior varieties, but the problems of long selection cycle and slow genetic progress have always been the "technical bottleneck" of breeding breakthrough new varieties
[0012] The application number is 201210042295.X, and the title of the invention is "A method for constructing transgenic pigs resistant to porcine circovirus type 2 disease". U6, the vector inserted into the genome contains the ampicillin resistance gene, so the obtained transgenic pigs are not conducive to the subsequent development of the safety test of genetically modified organisms, and in the patent, only the integration of the target gene into the genome was detected, and no Detect whether the siRNA is correctly expressed, which is the root of whether the transgenic pig can resist the disease. Therefore, it is still unknown whether the resulting transgenic pig can resist the disease

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Expression vector resisting porcine circovirus type 2 (PCV2) and transgenic pig, and construction methods thereof
  • Expression vector resisting porcine circovirus type 2 (PCV2) and transgenic pig, and construction methods thereof
  • Expression vector resisting porcine circovirus type 2 (PCV2) and transgenic pig, and construction methods thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Example 1 Anti-porcine circovirus type 2 piggyBac transposon expression vector: construction of pPB-H1-sh2-CMV-Neo / EGFP

[0054] Include the following steps:

[0055] (1), synthetic H1 promoter sequence

[0056] The sequence of the H1 promoter comes from the commercial vector pSilencer3.1-H1-neo plasmid (Ambion Company), and its length is 99bp. A restriction site XhoI was added to the 5' end of the H1 promoter sequence, and a restriction site EcoRI was added to the 3' end, and a company was commissioned to synthesize the sequence, and the synthesized H1 sequence was SEQ ID NO:1. Insert the H1 promoter sequence into the plasmid pUC57 (GenScript Biotechnology Co., Ltd.), named pUC57-H1; design primers (H1-F: GAACCCACTGCTTACTGGCTTATCG; H1-R: GGCTGGCAACTAGAAGGCACAGTCGAGGC) to amplify the H1 promoter in the plasmid pUC57-H1 subsequence, and then recover the PCR product; by figure 1 It can be seen that the size of the amplified sequence of the H1 promoter in the plasmid ...

Embodiment 2

[0092] Example 2 Using the expression vector constructed in Example 1 to construct a transgenic pig resistant to porcine circovirus type 2

[0093] Include the following steps:

[0094] 1. Screening for stably expressed monoclonal antibodies

[0095] The transposon plasmid pPB-H1-sh2-CMV-Neo / EGFP (i.e. the expression vector constructed in Example 1) and the transposase plasmid mPB (gifted by Sanger Institute) were mixed and co-transfected into a porcine fetal fibroblast cell line; Antibiotic-free cell growth medium containing 10% fetal bovine serum was used to resuscitate porcine fetal fibroblasts into a 60mm diameter cell culture dish, and the cells were used for transfection when they reached 50%-80% confluency. The transfection steps are as follows:

[0096] (1) Mix the transposon plasmid pPB-H1-sh2-CMV-Neo / EGFP and the transposase plasmid mPB at a molar ratio of 3:1 and add to 1000 μL In the centrifuge tube of I (life technology), mix well;

[0097] (2) PLUS TM Mix...

Embodiment 3 Embodiment 2

[0116] Example 3 The detection of the anti-porcine circovirus type 2 transgenic pig constructed in Example 2

[0117] Detect by the following method

[0118] 1. Green fluorescence detection

[0119] Directly irradiated with blue light for detection, transgenic positive pigs can emit green fluorescence, such as Figure 7 As shown, all anatomical organs of the transgenic pigs emit green fluorescence, which preliminarily proves that the transgenic plasmid resistant to porcine circovirus type 2 has been integrated and can be expressed in the transgenic pigs.

[0120] 2. Detection of DNA level

[0121] Detection of DNA level by PCR, southern blot, IPCR and other methods, Figure 8 For transgenic pig PCR, southern blot results, from Figure 8 It can be seen that the PCR amplification product of the DNA of the transgenic pig and the plasmid (the plasmid integrated into the transgenic pig is the carrier constructed in Example 1, but does not contain the Amp part) has the pPB-sh2 g...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
diameteraaaaaaaaaa
control rateaaaaaaaaaa
Login to View More

Abstract

The invention discloses an expression vector resisting PCV2 and a transgenic pig and construction methods thereof, belonging to the field of gene engineering. The expression vector is constructed by respectively connecting an H1 promoter and a pPB-sh2 sequence to a pUC57-H1 plasmid and then connecting a fusion fragment containing a loxP-Neo / EGFP gene expression cassette to pPB-H1-sh2. The vector is introduced into the genome of a pig, and somatic cell nuclear transfer technology is employed to produce the transgenic pig. The expression vector provided by the invention has a piggyback transposon, greatly improves transformation efficiency, changes a common plasmid series recombination transgene integration model into a single-site single-copy integration model and better simulates the internal environment of a biological gene. The constructed transgenic pig degrades PCV2mRNA through siRNA synthesized by itself, thereby fundamentally inhibiting PCV2 infection.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and more specifically, the invention relates to an expression vector resistant to porcine circovirus type 2 and a construction method thereof, and a transgenic pig resistant to porcine circovirus type 2 and a construction method thereof. Background technique [0002] Porcine circovirus, belonging to the family Circoviridae, is a single-stranded circular DNA virus, divided into type 1 and type 2. Among them, porcine circovirus type 1 (PCV1) is not pathogenic, while porcine circovirus type 2 (PCV2) is pathogenic. The PCV2 genome is a covalently closed, single-stranded circular DNA molecule with a size of approximately 1767 or 1768 nucleotides. It is speculated that PCV2 contains 11 open reading frames (Open reading frames, ORFs) of different sizes, among which ORF1, 2, 3, 4, 7 and 8 have certain homology, and the rest have no homology. ORF1, 5, 7 and 10 encoded by PCV2 are located on the genomi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/66C12N15/63C12N5/10C12N15/873A01K67/027
Inventor 徐志谦邹娴张献伟贺晓燕石俊松刘德武李紫聪吴珍芳
Owner SOUTH CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com