Primers and detection kit for avian leukosis J subgroup virus PCR detection
A technology of avian leukemia virus and detection kit, which is applied in the field of molecular biology, can solve the problems of inability to distinguish viruses, not suitable for whole group detection in farms, expensive, etc., and achieves the effects of convenient use, low cost, simple and fast operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] The design of embodiment 1 PCR primer
[0024] The two ends of the RNA genome of avian leukosis virus are non-coding regions, and the middle part is the coding region. There are 4 structural genes in the coding region, which are gag / pro-pol-env from 5' to 3'. The invention designs primers for the special env gene sequence of J subgroup avian leukosis virus. After multiple rounds of screening, the following primers were found to be able to quickly and accurately detect subgroup J avian leukosis virus qualitatively. Through PCR amplification, the individual who can obtain the fragmentation of the env gene sequence means that the individual contains J subgroup avian leukosis virus.
[0025] The nucleotide sequence of the primer that detects J subgroup avian leukosis virus provided by the invention:
[0026] Upstream primer: 5'TTAAACCGGACATCACCCCAAAAGGA 3' (SEQID No.1)
[0027] Downstream primer: 5'AGCACACCGAACCAAAGGTAACACA 3' (SEQ ID No.2).
Embodiment 2
[0028] The extraction of embodiment 2 total DNA
[0029] (1) Extraction of chicken blood DNA. Take 10 μL of citrate-anticoagulated blood sample into a 1.5mL Eppendorf tube, add 400 μL of buffer solution and shake gently; then add 100 μL of 47.765g / 100mL guanidine hydrochloride solution and 20 μl of proteinase K, vortex to mix and place at 56°C Digest in a metal bath for 5 hours; add 600 μL of chloroform, shake and centrifuge at 4°C, 12,000 rpm for 15 minutes, take the supernatant and transfer it to another Eppendorf tube; take the supernatant, add an equal volume of isopropanol, and put it in an ice box for precipitation 2 After 4 hours, centrifuge at 4°C, 15min, 12000rpm, pour the supernatant; add 777μL of absolute ethanol, centrifuge at 4°C, 12000rpm, 15min, discard the supernatant; add 48μL (appropriate amount) of ultrapure water to dissolve the precipitate (and obtain a DNA solution); The total DNA was detected with 0.8% agarose gel, and its concentration and purity were ...
Embodiment 3
[0031] Embodiment 3 Establishment of PCR amplification method
[0032] 1. PCR reaction system
[0033] The mixed total DNA of Example 2 was used as a template, and the primers of Example 1 were used as primers for PCR reaction. The 20 μL reaction system included 10 μL of PCR-Mix (purchased from Tiangen Company), ddH 2 O 7 μL, 1 μL of 10 pmol / μL upstream and downstream primers and 1 μL of chicken total DNA.
[0034] 2. PCR reaction conditions
[0035] The temperature of the primers was optimized using a temperature gradient PCR instrument, and 8 temperature gradients were screened between 52°C and 62°C. The PCR products were detected by 1.5% agarose gel electrophoresis, and the target band was finally selected. The most single, bright 55°C is the best PCR annealing temperature condition when using this kit.
[0036]After putting the PCR tube containing the sample into the PCR machine, set the following conditions for reaction: pre-denaturation at 95°C for 4 minutes; then den...
PUM
Property | Measurement | Unit |
---|---|---|
Sensitivity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap