Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A gAd gene of porcine globular adiponectin and protein encoded by gAd gene and application

A pig fat and spherical technology, applied in the field of expression of gAd protein in recombinant Lactococcus lactis, can solve the problems of not satisfying consumers, achieve the effect of improving intestinal microecological balance, reducing production costs, and reducing fat deposition

Inactive Publication Date: 2012-11-14
东莞市畜牧科学研究所 +1
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Almost fat-free lean meat can no longer meet the needs of consumers

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A gAd gene of porcine globular adiponectin and protein encoded by gAd gene and application
  • A gAd gene of porcine globular adiponectin and protein encoded by gAd gene and application
  • A gAd gene of porcine globular adiponectin and protein encoded by gAd gene and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] Example 1 Modification of gAd gene

[0047] In this example, TAKARA Total RNA Extraction Kit was used to extract total RNA from the adipose tissue of Blue Tang pigs. Based on the adiponectin gene (gene accession number: AY135647) released by GenBank, the adiponectin Ad gene was cloned by PCR, and primers were designed. The sequence is:

[0048] Upstream primer P1: 5'GGCTCTGATTCCACACCTG3';

[0049] Downstream primer P2: 5'CTCCTAATGACACTGAAGACCTC3'.

[0050] The reaction conditions are: 94°C for 3min, 94°C for 40s, 49°C for 30s, 72°C for 40s, 30 cycles, and finally 72°C for 7min.

[0051] After the sequencing is correct, use this sequence to design primers to amplify gAd, select the gene of the globular domain of porcine adiponectin, intercept 414 bases of the globular domain, and introduce it upstream Nco I enzyme cleavage site and 6 histidines, introduced downstream Sac I restriction site. The primer design sequence is as follows:

[0052] Upstream primer P3: ...

Embodiment 2

[0059] Example 2 Construction of pNZ8048-gAd prokaryotic expression plasmid

[0060] The gAd gene was inserted into the Lactococcus lactis expression vector through restriction endonuclease and ligase.

[0061] The specific operation is:

[0062] Nco I and Sac I double-enzyme-digest the pMD18-T-gAd and pNZ8048 prokaryotic expression plasmids respectively, and recover from the gel. Ligate overnight at 16°C, then transform into the cloning host Escherichia coli by conventional chemical transformation method E. coli MC1061, chloramphenicol resistance screening, pick 10 positive colonies, and carry out PCR amplification respectively, using primers P3, P4 and the aforementioned reaction procedures and conditions. recombined plasmid Nco I. Sac I double enzyme digestion identification, refer to the appendix figure 1 , with figure 1 Among them, M represents DNA marker, 1 and 2 represent pNZ8048-gAd Nco I and Sac Ⅰ product of digestion, 3 represents the pNZ8048-gA...

Embodiment 3

[0064] Embodiment 3 The preparation of the recombinant microorganism containing the prokaryotic expression vector of gAd gene

[0065] Electroporate the correctly identified plasmid carrying gAd expression, the parameters are set to 2.5kV, 25aF, 400Ω, and transformed into L. Lactis NZ9000. Pick a single colony and inoculate it into GM containing chloramphenicol (5 μg / ml) 17 In liquid medium, culture overnight at 30°C. On the next day, 10 positive colonies were selected from the single colonies grown in the culture medium, and PCR amplification was performed respectively, using primers P3 and P4 and the aforementioned reaction procedures and conditions. recombined plasmid Nco I. Sac I double enzyme digestion identification, when the size of the DNA fragment obtained is consistent with that of Example 2, the recombinant Lactococcus lactis NZ9000-gAd is obtained. See the attached microscopic pictures for the strains Figure 10 。

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gAd gene of porcine globular adiponectin, a protein encoded by the gAd gene and application. A method comprises the following steps of: designing primers, namely P3 and P4 on the basis of a sequence of the gAd, adding six His labels at a terminal 5'of the gAd gene, cloning a gene fragment to a cloning host, namely Escherichia coli, identifying and amplifying a recombinant plasmid, performing electroporation on an expression host, namely Lactococcus lactis by using the plasmid, further screening to obtain a modified Lactococcus lactis strain which can efficiently express the gAd, preparing an antiserum specifically resisting the gAd, and determining that the gAd protein expressed in vitro has the reactogenicity. A lactic acid bacteria microecological preparation rich in the porcine globular adiponectin is prepared; and an important basis is laid for regulating fat metabolism and fat deposition of pigs by expressing adiponectin by recombinant Lactococcus lactisNZ9000.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to the gAd gene of porcine adiponectin globular domain protein and the expression of the encoded gAd protein in recombinant Lactococcus lactis. Background technique [0002] Pig is an animal with a lot of fat deposition. Controlling pig fat deposition, increasing lean meat percentage, and at the same time ensuring the food safety of pork has always been a hot spot in pig breeding and nutrition research at home and abroad. [0003] The use of "clenbuterol" to increase lean meat poses a threat to consumers' health. For a long time, improving the lean meat rate of pigs has been the goal pursued by the farming practitioners, because the higher the lean meat rate, the more significant the economic benefits of raising pigs. Therefore, in order to achieve the purpose of increasing the lean meat rate, many farmers illegally use "clenbuterol" and other prohibited dru...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/11C12N15/16C12N15/74C12N1/21C07K14/575C12R1/46
Inventor 胡文锋刘霭莎吴同山李岩王敬军
Owner 东莞市畜牧科学研究所
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com