Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Soluble VEGFR (Vascular Endothelial Growth Factor Receptor) difunctional chimera receptor VEGFR31-Ig as well as preparation method and application thereof

A VEGF-B, vegfr31-ig technology, applied in chemical instruments and methods, antibodies, hybrid peptides, etc., can solve the problems of poor treatment effect, unrealized metastasis, and poor prognosis of malignant tumors.

Inactive Publication Date: 2011-07-27
SHANGHAI NAT ENG RES CENT OF ANTIBODY MEDICINE
View PDF1 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The treatment effect of malignant tumors is poor, the late metastasis rate is high, and the prognosis is often poor
Although conventional treatment methods such as radiotherapy, chemotherapy and surgery are currently used clinically, although the pain is relieved to a large extent and the survival time is prolonged, these methods have great limitations, and the curative effect is difficult to further improve.
[0003] The growth of tumor has two distinct stages, that is, from the slow growth period without blood vessels to the rapid proliferation period with blood vessels. The formation of blood vessels enables the tumor to obtain enough nutrition to complete the vascular switching period. If there is no angiogenesis, The growth of the primary tumor does not exceed 1 to 2 mm, and metastasis cannot be achieved

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Soluble VEGFR (Vascular Endothelial Growth Factor Receptor) difunctional chimera receptor VEGFR31-Ig as well as preparation method and application thereof
  • Soluble VEGFR (Vascular Endothelial Growth Factor Receptor) difunctional chimera receptor VEGFR31-Ig as well as preparation method and application thereof
  • Soluble VEGFR (Vascular Endothelial Growth Factor Receptor) difunctional chimera receptor VEGFR31-Ig as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] Example 1. Cloning of Human Antibody Light and Heavy Chain Constant Regions and Fc Region Genes

[0055] Isolate healthy human lymphocytes with lymphocyte separation medium, and extract total RNA with Trizol reagent (Invitrogen company product), according to literature (Cell, 1980, 22: 197-207) and literature (Nucleic Acids Research, 1982, 10: 4071-4079) Primers were designed to amplify the heavy chain and light chain constant region genes of the reported sequence, and the Fc region of the antibody was amplified with primers FC sense: GAAGCTTAATAATGGCCCGGGCGAGCCCAAATCTTGTGAC and FC antisense: CGAATTCTCATTTACCCGGAGACAGG. All PCR reactions were hot-started, and the reaction conditions were: 94°C for minutes; 94°C for 45 seconds, 60°C for 45 seconds, 72°C for 1 minute and 10 seconds, 30 cycles; 72°C for 10 minutes. The PCR product was purified and recovered by agarose gel electrophoresis and cloned into the pGEM-T vector. After sequencing verification, it was confirmed tha...

Embodiment 2

[0056] Example 2. Construction of soluble bifunctional VEGFR fusion receptor VEGFR31-Ig

[0057] VEGFR12 and VEGFR23 genes were synthesized by Shanghai Bioengineering Technology Service Co., Ltd. according to the sequences in NM_002019 and NP_002244, and human antibody light chain constant region (k constant region) genes (using primers LC sense: ACTGTGGCTGCACCATCTGT; LC antisense: GAATTCCTAACACTCTCCCCTGTTG and pGEM-T / CL as a template) was ligated by overlapPCR (see SEQ ID NO: 3 for the sequence), and was cloned into the pGEM-T vector (Promega company product), positive clones were selected, sequenced correctly, and digested with HinDIII and EcoRI ( Promega company product), purified and recovered by agarose gel electrophoresis to obtain a 1 kb restriction enzyme fragment and isoenzyme-digested plasmid pDR1 ( figure 1 ) were ligated with T4 DNA ligase (product of Invitrogen Company) to construct eukaryotic expression vector pDR (VEGFR31-Ig-L). Figure 5 It is the gene structu...

experiment example 1

[0061] Experimental example 1. Affinity detection experiment of soluble bifunctional VEGFR fusion receptor-ELISA method

[0062] Experimental procedure: Dilute VEGF-A and VEGF-C (products of R&D Company) with 0.05mmol / L sodium carbonate-sodium bicarbonate buffer solution (pH 9.6) to 2ug / ml, 100ul / well, and coat overnight at 4°C. After blocking with 3% skimmed milk at room temperature for 2 hours, different concentrations of soluble VEGFR fusion receptors VEGFR31-Ig, VEGFRIg, and VEGFRIgM were added, 100ul / well, and three parallel wells were taken for each concentration. PBS was used as a negative control and incubated at room temperature for 2 hours. Discard the supernatant, wash with PBS three times, add HRP-labeled mouse anti-human IgG monoclonal antibody (product of DAKO Company) diluted according to the titer, 50ul / well, and incubate at room temperature for 45min. After fully washed with PBS, OPD was protected from light for color development, and 2mol / L H 2 SO 4 After t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a soluble VEGFR (Vascular Endothelial Growth Factor Receptor) difunctional chimera receptor VEGFR31-Ig as well as a preparation method and application thereof in preparing antineoplastic drugs. The soluble VEGFR difunctional chimera receptor VEGFR31-Ig disclosed by the invention can not only be combined with VEGF-A and VEGF-B, but also be combined with VEGF-C or VEGF-D, and can be used for preparing the antineoplastic drugs.

Description

technical field [0001] The invention belongs to the field of biotechnology, and more specifically, the invention discloses a kind of bifunctional fusion receptor, its preparation method and its application in the preparation of antitumor drugs. Background technique [0002] Tumors, especially malignant tumors, are diseases that seriously endanger human health in the world today, ranking second among the deaths caused by various diseases. And in recent years, its incidence has shown an obvious upward trend. The curative effect of malignant tumors is poor, the rate of advanced metastasis is high, and the prognosis is often poor. Although conventional treatment methods such as radiotherapy, chemotherapy and surgery are currently used clinically, although the pain is relieved to a large extent and the survival time is prolonged, these methods have great limitations, and the curative effect is difficult to further improve. [0003] The growth of tumor has two distinct stages, t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N15/62C12N15/85C12N5/10C12P21/02A61K39/395A61K38/17A61P35/00
Inventor 郭亚军张大鹏谈珉钱卫珠李博华
Owner SHANGHAI NAT ENG RES CENT OF ANTIBODY MEDICINE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com