LAMP detection method for babesia bovis
A technology for the detection of Babesia bovis and its detection method, applied in the field of LAMP detection of Babesia bovis, can solve the problems of lack of stability and regularity of results, expensive experimental conditions, high false positive rate, etc., achieve convenient and fast detection, and simple instrument requirements , high specificity and sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0021] Set up the LAMP Assay Kit, which includes:
[0022] (1) Dof tube: the reaction tube contains 10×LAMP Buffer, deoxyribonucleoside triphosphate (dNTP), primer F3, primer B3, primer FIP, primer BIP and MgSO 4 . Primer F3, primer B3, primer FIP, and primer BIP are DNA fragments synthesized by a DNA synthesizer according to the following base sequences:
[0023] Primer F3 5'>GGTTGGGCAATGCGTTAT<3'
[0024] Primer B3 5'>TGTCCGTAAGGAAGAACAT<3'
[0025] Primer FIP 5'>CACAATCCCTTTTAGCATATGTAGCA
[0026] GGGCCCTTTCACGCTCAATGTGTTTC<3'
[0027] Primer BIP 5'>GTACTCAAGCAGATATCTACCATGGGG
[0028] GCCCAACCTAAGAAAGCAATAGCCATA<3'
[0029] (2) Positive control: This control is a recombinant plasmid containing the target gene fragment. The construction method is: clone the amplified product into pUCm-T to transform DH5-α competent cells, and obtain a positive recombinant plasmid after enzyme digestion identification and sequencing. The plasmid contains a 1092bp gen...
Embodiment 2
[0035] 1. Collection of specimens: Strictly aseptically collect blood samples of no less than 500 μl from suspected diseased cattle, and store them at 4°C or frozen;
[0036] 2. DNA extraction of the tested specimen: Take 200 μl of sterile anticoagulated blood, add 100 μl of Trizol reagent, mix thoroughly, add an equal volume of Tris saturated phenol / chloroform mixture for extraction, and precipitate the supernatant with 2 times the volume of absolute ethanol After 2 hours, wash with 70% ethanol and dry, dissolve the precipitate with 10-20 μl TE buffer, and store at 4°C for later use;
[0037] 3. Set the LAMP detection kit with reference to Example 1;
[0038] 4. LAMP amplification: add the treated sample DNA into the Dof tube, and set negative and positive controls at the same time. The reaction system of each tube is: 1mmol / L FIP, 1mmol / L BIP, 0.2mmol / L F3, 0.2mmol / LB3 , 4mmol / L MgSO4, 0.8mmol / L dNTP, 0.8mmol / L betaine, 10×LAMP Buffer, 1μL DNA template. Add 8U Bst DNA poly...
Embodiment 3
[0041] The method is basically the same as that in Example 1. The bovine blood samples are collected aseptically at random, DNA is extracted, amplified by LAMP method, and observed by electrophoresis. See results figure 2, where 1 is positive control, 2 is negative control, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 21, 22, 23 and 24 were negative, and 16 was positive. The positive rate was 4.55%.
[0042]
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com