Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

LAMP detection method for babesia bovis

A technology for the detection of Babesia bovis and its detection method, applied in the field of LAMP detection of Babesia bovis, can solve the problems of lack of stability and regularity of results, expensive experimental conditions, high false positive rate, etc., achieve convenient and fast detection, and simple instrument requirements , high specificity and sensitivity

Active Publication Date: 2011-02-16
ZHEJIANG UNIV
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

More sensitive methods, such as conventional PCR detection technology, reverse linear blot hybridization (RBL) and PCR-ELISA, have also been reported, but these methods have the disadvantage of high false positive rate
In addition, for reasons of economy and practical application, most methods are not suitable for laboratory diagnosis of epidemiology, especially real-time quantitative PCR technology, which must use more expensive experimental conditions and require higher professional skills, and because of The PCR instrument needs to be in a high temperature, high humidity, and even dusty environment, which often makes the results lack stability and regularity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • LAMP detection method for babesia bovis
  • LAMP detection method for babesia bovis
  • LAMP detection method for babesia bovis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Set up the LAMP Assay Kit, which includes:

[0022] (1) Dof tube: the reaction tube contains 10×LAMP Buffer, deoxyribonucleoside triphosphate (dNTP), primer F3, primer B3, primer FIP, primer BIP and MgSO 4 . Primer F3, primer B3, primer FIP, and primer BIP are DNA fragments synthesized by a DNA synthesizer according to the following base sequences:

[0023] Primer F3 5'>GGTTGGGCAATGCGTTAT<3'

[0024] Primer B3 5'>TGTCCGTAAGGAAGAACAT<3'

[0025] Primer FIP 5'>CACAATCCCTTTTAGCATATGTAGCA

[0026] GGGCCCTTTCACGCTCAATGTGTTTC<3'

[0027] Primer BIP 5'>GTACTCAAGCAGATATCTACCATGGGG

[0028] GCCCAACCTAAGAAAGCAATAGCCATA<3'

[0029] (2) Positive control: This control is a recombinant plasmid containing the target gene fragment. The construction method is: clone the amplified product into pUCm-T to transform DH5-α competent cells, and obtain a positive recombinant plasmid after enzyme digestion identification and sequencing. The plasmid contains a 1092bp gen...

Embodiment 2

[0035] 1. Collection of specimens: Strictly aseptically collect blood samples of no less than 500 μl from suspected diseased cattle, and store them at 4°C or frozen;

[0036] 2. DNA extraction of the tested specimen: Take 200 μl of sterile anticoagulated blood, add 100 μl of Trizol reagent, mix thoroughly, add an equal volume of Tris saturated phenol / chloroform mixture for extraction, and precipitate the supernatant with 2 times the volume of absolute ethanol After 2 hours, wash with 70% ethanol and dry, dissolve the precipitate with 10-20 μl TE buffer, and store at 4°C for later use;

[0037] 3. Set the LAMP detection kit with reference to Example 1;

[0038] 4. LAMP amplification: add the treated sample DNA into the Dof tube, and set negative and positive controls at the same time. The reaction system of each tube is: 1mmol / L FIP, 1mmol / L BIP, 0.2mmol / L F3, 0.2mmol / LB3 , 4mmol / L MgSO4, 0.8mmol / L dNTP, 0.8mmol / L betaine, 10×LAMP Buffer, 1μL DNA template. Add 8U Bst DNA poly...

Embodiment 3

[0041] The method is basically the same as that in Example 1. The bovine blood samples are collected aseptically at random, DNA is extracted, amplified by LAMP method, and observed by electrophoresis. See results figure 2, where 1 is positive control, 2 is negative control, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 21, 22, 23 and 24 were negative, and 16 was positive. The positive rate was 4.55%.

[0042]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a loop-mediated isothermal amplification (LAMP) detection method for babesia bovis. The method comprises the following steps of: extracting deoxyribose nucleic acid (DNA) of a specimen to be detected; setting an LAMP detection kit; performing LAMP amplification; analyzing amplification products; and determining by comparing color change of the specimen to be detected, a positive control and a negative control. The method can conveniently, quickly and accurately detect the babesia bovis in the specimen to be detected, and can be used for surveying molecular epidemiology of the babesia bovis and monitoring treatment effects. By the detection method, a template is easy to prepare, the cost is low, and the specificity and sensitivity can be improved. The result can be observed by naked eyes by adding an appropriate amount of SYBR GREEN I dyes, the instrument requirement is low, the consumed time is short, the result judgment is simple, the specificity and the sensitivity are high, the requirements of clinical detection can be met, and the prospect is wide.

Description

technical field [0001] The invention relates to biotechnology, in particular to a detection method for Babesia bovis LAMP. Background technique [0002] Babesia bovis is a kind of protozoan that is transmitted by ticks and parasitizes in red blood cells. It belongs to the subphylum Polytope. The babesia disease caused by this type of parasite occurs and prevails in many parts of the world, and it often occurs in various parts of my country. , causing huge losses to animal husbandry and the national economy. After cattle are infected with the worm, symptoms such as anemia, fever, hemoglobinuria, and ataxia often occur, and death may occur in severe cases. The disease has caused huge economic losses and is expanding in scope, thus attracting widespread attention from scholars at home and abroad. At present, blood smear microscopy of blood samples is still the most suitable method for diagnosing bovine babesiosis, but this method has a major disadvantage - low sensitivity, so ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68G01N21/64
Inventor 杜爱芳王素华李群周前进
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com