Double expression plasmid of hepatitis B virus, and construction method and application thereof
A technology of hepatitis B virus and construction methods, applied in the direction of antiviral agents, microorganism-based methods, biochemical equipment and methods, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0070] Example 1 Construction of Hepatitis B Virus Pre-C-C Gene Vaccine
[0071] 1. Nested PCR amplification of ENHII-PreC-C gene
[0072] Select the blood of patients with viral hepatitis, chronic hepatitis B (moderate), positive for HBVDNA and HBeAg. Serum HBV DNA was extracted and sequenced, and typed as adr subtype. Heparin anticoagulant blood of patients with chronic hepatitis B was 3ml, centrifuged at 2000rpm for 3min, and the serum was separated. Using the QIAGEN kit, the steps to extract HBV DNA are as follows:
[0073] ①Mix 200 μl of serum and 20 μl of protease, ②Add 200 μl of Buffer AL, mix evenly, ③Add 200 μl of absolute alcohol, mix evenly, incubate at 56°C for 10 minutes, ④Centrifuge at 10000rpm for 1min, pass through the column, discard the centrifugate, ⑤Add 1500μl of BufferAW, and centrifuge at 10000rpm Rinse for 1 min, discard the centrifugate, ⑥ add 500 l of BufferAW2, centrifuge at 14000 rpm for 5 min, discard the centrifugate, ⑦ centrifuge again at 14000...
Embodiment 2
[0099] Example 2 Construction of the pre-S-S gene vaccine of hepatitis B virus
[0100] 1. Nested PCR amplification of PreS-S-ENH I gene
[0101] Using HBV plasmid G683-1 as template, using S2-5 (forward, 5′-AAACTGCAGCATCCTCAGGCCATG,) and S3E (reverse, 5′-GGATCCCTAGGAGTTCCGCAGTATGG) as primers, the PCR method in Part 1 of Example 1 was used to amplify increase, such as Figure 5 , 1 μl of template, 1 μl of each primer (25 μM), 2 μl of 5mMdNTP, 5 μl of 10×PCR Buffer, 1 μl of Taq enzyme, H 2 O 39μl, denaturation at 94°C for 3min→denaturation at 94°C for 1min, annealing at 52°C for 1min, extension at 72°C for 1min, a total of 35 cycles→extension at 72°C for 10min. The amplified product is the HBVPreS-S-ENH I gene. The size was identified by 1% agarose gel electrophoresis to be about 1.3kb, which was in line with the expected length.
[0102] 2. Construction of recombinant plasmid VES:
[0103] The method is the same as in the second part of Example 1. The PCR product is conn...
Embodiment 3
[0104] Example 3 Insertion Mutation of Recombinant Plasmid VES
[0105] The insertion mutation of the VES plasmid is realized by single primer secondary PCR amplification:
[0106] 1. Synthesize 1 pair of primers for introducing insertion mutations, insert Nhe I, Pac I, Fse I and Age I restriction sites: VR-forward: 5'-GGTGCTGAAGAATTGCTAGCTTAATTAAGGCCGGCCACCGGTTCCTCCTGGG, the sequence is as SEQ ID NO: 5;
[0107] VR-reverse: 5'-TGGCCGGCCTTAATTAAGCTAG, sequence as SEQ ID NO: 6
[0108] (Insert sequence in bold italics)
[0109] 2. The first round of PCR: use the VES plasmid as a template, add forward primer VR-forward, and PCR amplification, the reaction volume and conditions are as follows: template (VES0.1μg / μl) 2μl, primer VR-forward (25μM) 2μl, dNTP (5mM) 2μl, 10×PCR Buffer 2.5μl, Pfu enzyme 1μl, H 2 O16.5 μl, reaction conditions: denaturation at 94°C for 1 min→denaturation at 94°C for 1 min, annealing at 52°C for 1 min, extension at 72°C for 12 min, and extension at 72°...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com