Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Preparation and use of swine foot-and-mouth disease recombinant immune composite peptide

A porcine foot-and-mouth disease and immune complex technology, which is applied in the field of genetic engineering to produce immune adjuvants, can solve the problems of unsuitability for field promotion, impact on actual effects, high content of foreign proteins, etc., and achieve mass production, enhanced immunogenicity, and simple purification process Effect

Inactive Publication Date: 2010-10-20
NANJING AGRICULTURAL UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Since the natural BS can only be extracted from the chicken bursa tissue, the source is very limited, and the content of other impurities is high, so the purification is difficult, and its actual effect is also greatly affected
Chemically synthesized BS is expensive and not suitable for field promotion

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation and use of swine foot-and-mouth disease recombinant immune composite peptide
  • Preparation and use of swine foot-and-mouth disease recombinant immune composite peptide
  • Preparation and use of swine foot-and-mouth disease recombinant immune composite peptide

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0055] 1 Overlap PCR (SOE) Amplification of Recombinant Immune Complex Peptide Gene of Porcine Foot-and-Mouth Disease

[0056] The porcine foot-and-mouth disease recombinant immune complex peptide gene was designed according to the Escherichia coli biased codon, and the EcoRI restriction site was added to the primer F1, and the stop codon and the SalI restriction site were added to the primer F3 respectively. See ( figure 1 )

[0057] Primer F1, SEQ.ID.NO.2:

[0058] 5'-CCG GAATTC GGCGGCGGCGGCAGCGATGATGATGATAAAATTAGCATTAGCGAAATTAAAGGCGTG-3’EcoRI

[0059] Primer F2, SEQ.ID.NO.3:

[0060] 5'-GGGGTGCTGCCGCCGCCGCCAAACAGAATGGTTTCAATTTTATGCACAATCACGCCTTTAATTTCG-3'

[0061] Primer F3, SEQ.ID.NO.4:

[0062] 5’-GCGGCGGCAGCACCCCGAACCTGAAACATGGCACCCCGAACCTGAAACATGGCTAA GTC GAC TCG-3'SalI

[0063] Primers were synthesized by Shanghai Invitrongen Company

[0064] PCR reaction system 50μl: 10×PCR Buffer, 5μL, MgCl 2 , 3 μL; dNTP, 10 mmol / L, 1 μL; primers F1, F2 and primer F2, 2 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for constructing porcine fmd recombinant immune complex peptide and an application thereof, which belongs to the technical field of biological engineering. The immune multi-peptide adjuvant is fused with aphthovirus novel auxiliary T cell epiposition (I-S-I-S-E-I-K-G-V-I-V-H-K-I-E-T-I-L-F) and Bursin mimic peptide (T-P-N-L-K-H-G) by a flexible Linker. A fusion gene is inserted into an expression carrier to be converted into colon bacillus, gene engineering strains which express the porcine fmd recombinant immune complex peptide with high efficiency are obtained, and the fusion protein of the porcine fmd recombinant immune complex peptide is obtained after liquid culture and purification; the thioredoxin in the fusion protein is removed by enterokinase with His label on the N end, and the single porcine fmd recombinant immune complex peptide can be obtained after affinity chromatography purification with very high sample purity. The recombinant immune complex peptide can serve as the novel immune multi-peptide adjuvant of the foot-and-mouth disease vaccine. Animal immune experiments prove that the method has high safety but no toxicity and side effect, and can effectively enhance the immunity of organisms and cells and the immunity level of body fluid.

Description

technical field [0001] The invention relates to a preparation method and application of porcine foot-and-mouth disease recombinant immune complex peptide, and belongs to the technical field of genetic engineering production of immune adjuvants in the biotechnology pharmaceutical industry. Background technique [0002] Foot-and-mouth disease (FMD) is a severe infectious disease caused by foot-and-mouth disease virus (FMDV), which mainly infects artiodactyla animals. In addition to the direct economic loss caused by the death of animals, the stoppage of meat and milk production during the period of animal illness leads to the suspension of import and export trade of livestock products in the region and even the country, which also causes huge economic losses. Therefore, countries all over the world attach great importance to the prevention and control of this disease. [0003] FMDV infection requires the participation of B cells and T cells to produce neutralizing antibodies....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/62C12N15/70C12N1/21C07K19/00A61K39/39A61P31/14C12R1/19
Inventor 陈溥言王臣魏建超曹瑞兵周斌
Owner NANJING AGRICULTURAL UNIVERSITY
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More