Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Test paper strip for rapidly detecting brucellosis IgM antibody colloidal gold

A technology for detecting brucella, which is applied in the field of brucella IgM antibody detection test strips, can solve problems such as misdiagnosis, atypical clinical symptoms, and insufficient understanding of brucellosis, and achieve clear and easy to distinguish results, Save manpower and material resources, simple operation effect

Inactive Publication Date: 2009-02-11
BEIJING ZHUANGDI HAOHE BIOMEDICINE SCI & TECH
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The main reasons for long-term misdiagnosis are as follows: (1) Insufficient understanding of brucellosis by clinicians is the main reason for misdiagnosis
(2) The epidemiological information is not detailed, especially the medical history, contact history, occupation, eating habits, living area and endemic area, etc.
(3) Diversified clinical manifestations and atypical clinical symptoms
(4) Lack of simple, rapid, specific and sensitive detection methods

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Test paper strip for rapidly detecting brucellosis IgM antibody colloidal gold
  • Test paper strip for rapidly detecting brucellosis IgM antibody colloidal gold
  • Test paper strip for rapidly detecting brucellosis IgM antibody colloidal gold

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Embodiment 1: the preparation of Brucella outer membrane protein bp26 genetic engineering antigen

[0030] (1) Obtaining the target gene

[0031] According to the sequence of the target gene fragment (GenBank accession number is AY166769) and the characteristics of the pGEX-4T-1 (Pharmacia) expression vector, primers containing restriction enzymes EcoR1 and Xho1 restriction sites at both ends were designed:

[0032] 5'gaattcatgaacactcgtgct3'

[0033] 5'gcctcgagttacttgatttcaa3'

[0034] Then, the target gene fragment bp26 was amplified from the Brucella genome. The amplification conditions were: denaturation at 95°C for 5 minutes; 1 minute at 95°C, 1 minute at 49.8°C, and 1 minute at 70°C for 35 cycles; finally, extension at 70°C for 10 minutes.

[0035] (2) Cloning of the target gene and screening of positive recombinants

[0036] After electrophoresis, the PCR amplified product was recovered by gel cutting, ligated with the PMD-18T cloning vector overnight at 16°C, ...

Embodiment 2

[0045] Embodiment 2: Brucella IgM antibody colloidal gold quick detection test strip (referring to Fig. 1)

[0046] (1) Preparation of colloidal gold-anti-human IgM conjugate:

[0047]It was determined by experiments that the optimal binding pH value of the anti-human IgM monoclonal antibody colloidal label was 8.0, and the ratio of colloidal gold and antibody was 28 μg / ml colloidal gold. After the labeled colloidal gold is treated with a stabilizer (0.5% BSA, pH8.0, 0.01M Tris buffer), take the colloidal gold-antibody conjugate solution in an amount of 65 μl per square centimeter, evenly adsorb on glass fiber, and freeze-dry , and stored in a dry environment.

[0048] (2) Coating antigen on nitrocellulose membrane:

[0049] Dilute bp26 to 3mg / ml with 0.01M PBS. Anti-mouse IgG was diluted to 2mg / ml with 0.01M PBS. Spray the two on the nitrocellulose membrane at a speed of 1 μl / cm with a film spraying machine to form a test line and a control line, respectively. The interv...

Embodiment 3

[0056] Embodiment 3 detection method (see figure 2 )

[0057] Add 100-150 ul of the patient's whole blood, plasma or serum specimen dropwise directly to the "4" of the test strip in Example 2, and the sample solution goes up the membrane, and the result is interpreted within 10-15 minutes.

[0058] result:

[0059] If the detection sample contains Brucella IgM antibody, it will form a corresponding complex with the colloidal gold-labeled anti-human IgM monoclonal antibody on the test strip, and the upstream is specific for Brucella coated on the nitrocellulose membrane. The antigen binds to form a red line, that is, a red band is formed at T.

[0060] Regardless of whether the specimen contains the corresponding antibody or not, the colloidal gold-labeled anti-human IgM monoclonal antibody continues to crawl upward and forms a red precipitation line with the anti-mouse IgG coated on the membrane, that is, a red band is formed at "C". This line is a quality control line. If ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a test strip for rapid detection of a Brucella IgM antibody, which comprises a reaction film and a conjugate release pad. The reaction film has a detection band simultaneously coated with Brucella specific antigen bp26, and a quality control band coated with a double-antibody. The conjugate release pad is coated with colloidal golden labeled anti-human IgM monoclonal antibody. A membrane chromatography indirect sandwich method is adopted to detect the Brucella specific IgM antibody in a specimen. The test strip is simple in operation, convenient, and fast, and has the advantages of no requirements of special instruments and special training, clear and identified result, and easy popularization. The test strip is suitable for base course, site detection and early diagnosis, and has auxiliary effect on the diagnosis of Brucella infection.

Description

technical field [0001] The invention belongs to the field of biological detection, and in particular relates to a Brucella IgM antibody detection test strip and an application thereof. Background technique [0002] Brucellosis is a zoonotic infectious disease caused by Brucella, commonly known as wave fever. The clinical features are long-term fever, hyperhidrosis, arthralgia, fatigue, hepatosplenomegaly, etc. The disease is prevalent in different degrees in various countries in the world. [0003] People are mainly infected through the skin, mucous membranes, digestive tract and respiratory tract, especially Brucella melis and Brucella bovis. Brucella suis infection is rare in humans, Brucella canis infection is rare, and Brucella sheep epididymis and Brucella sarira basically do not infect humans. [0004] Brucellosis is easily misdiagnosed as rheumatic disease, typhoid fever, tuberculosis, viral infection, or as the cause of long-term fever to be investigated, diagnosed...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G01N33/577G01N33/569G01N33/558G01N33/545
Inventor 刘明
Owner BEIJING ZHUANGDI HAOHE BIOMEDICINE SCI & TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com