Fusion polypeptide with antimicrobial and wound healing promoting function
A fusion polypeptide and wound healing technology, applied in the field of biomedicine, can solve the problems of low yield of naturally extracted antimicrobial peptides, too small molecular weight of antimicrobial peptides, and difficulty in separation and purification, so as to accelerate wound healing, increase molecular weight, and reduce separation and purification. effect of difficulty
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0027] Example 1 Fusion polypeptide with antibacterial and wound healing functions
[0028] (1) Eukaryotic expression of hEGF-antimicrobial peptide fusion polypeptide
[0029] Primers P1 (see SEQ ID NO.5 in the sequence listing for the sequence), P2 (see SEQ ID NO.6 in the sequence listing for the sequence), P3 (see SEQ ID NO.7 in the sequence listing for the sequence) and P4 ( For the sequence, see SEQ ID NO.8 in the sequence listing) for constructing human epidermal growth factor gene (hEGF); specific primers E1 (see SEQ ID NO.9 in the sequence listing) and E2 (see SEQ ID NO.9 in the sequence listing for the sequence) 10), used to amplify hEGF and add EcoRI restriction site and thrombin restriction site to its 5' and 3' ends respectively.
[0030] P1: AATAGTGACTCTGAATGTCCCCTGTCCCACGATGGGTACTGCCTCCATGATGGTG;
[0031] P2: CATACTTGTCCAATGCTTCAATATACATGCACACACCATCATGGAGGCAGTACC;
[0032] P3: TGAAGCATTGGACAAGTATGCATGCAACTGTGTTGTTGGCTACATCGGG;
[0033] P4: CCACCACTTCAGGTCTCGGT...
Embodiment 2
[0043] Example 2: Antibacterial experiment of fusion polypeptide thrombin digestion product
[0044] Antibacterial activity in vitro was detected by agar diffusion method. The tested strains were the standard strain of Bacillus cereus (CGMCC1.126); hemorrhagic Escherichia coli 0157, Acinetobacter baumann's hemolyticus, Enterobacter aerogenes, Staphylococcus auris, Klebsiella pneumoniae, Staphylococcus aureus, B Salmonella paratyphi type, Pseudomonas aeruginosa isolates. The undigested fusion polypeptide and normal saline were used as controls. The results showed that the enzyme-digested polypeptides had a strong killing effect on all the above-mentioned tested strains, and the diameter of the inhibition zone was greater than 20mm (Φ<8mm was regarded as having no antibacterial activity). There was no significant difference in the diameter of the inhibition zone among different strains. Undigested fusion polypeptide and saline have no antibacterial activity.
Embodiment 3
[0045] Example 3: Mitogenic activity experiment of fusion polypeptide thrombin cleavage product
[0046] Primary cultured rat lung fibroblasts and human embryonic kidney HEK293 cell lines were used as test cells. The cell growth-promoting activity of fusion polypeptide digestion products was analyzed by MTT method, and human epidermal growth factor (hEGF) standard was used as positive control, and Hanks buffer was used as negative control. The test results showed that both the thrombin cleavage product of the fusion polypeptide and hEGF could significantly promote cell division, and there was no significant difference between them, but the difference was extremely significant compared with the negative control.
PUM
Property | Measurement | Unit |
---|---|---|
diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com