Yeast engineering bacterium for producing human pepsinogen and its preparation method and application
A pepsinogen and yeast engineering technology, which is applied to the field of yeast engineering bacteria producing human pepsinogen and its preparation, can solve the problem of porcine pepsinogen protein sequencing, purification, expression without data results, and biochemical properties that need further study , shortage of supply of human gastric tissue, etc., to achieve the effect of low production cost, good application value and significant economic benefits
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0047] Embodiment 1 constructs recombinant PGC expression plasmid
[0048] Using the reverse-transcribed cDNA of human stomach tissue total RNA as a template, the natural PGC gene fragment was amplified by PCR, and enzyme cutting sites XhoI and NotI were introduced into the 5' end and 3' end of the PGC gene coding sequence respectively. The secretory expression vector pPIC9k (purchased from Invitrogen) of P. pastoris was loaded to obtain a recombinant expression plasmid (see FIG. 1 ).
[0049] (1) The primer sequence for cloning the natural PGC gene fragment is:
[0050] 5' direction primer: GCAGTGGTCAAAGTGCCCCTG (SEQ ID NO: 1)
[0051] 3' direction primer: CTAGGCGGCAGTGGCAAAGC (SEQ ID NO: 2)
[0052] (2) The primer sequence of the pPIC9K expression vector is:
[0053] 5' direction primer
[0054] (GACCCAAT)CTCGAG(xhoI site)GCAGTGGTCAAAGTGCCCCTG (SEQ ID NO: 3)
[0055] 3' Direction Primer
[0056] (GT) GC GGC CGC (NotI site) TTA (stop codon) GGCGGCAGTGGCAAAGC (SEQ ID NO:...
Embodiment 2
[0057] Example 2 Electrotransformation of recombinant expression plasmid Pichia methanolica GS115
[0058] The constructed expression plasmid pPIC9k-pgc was digested with SalI and linearized. The host strain P. pastoris GS115 (His mut+) purchased from Invitrogen was cultivated to OD of 1.6-1.8 to prepare electrocompetent cells, mixed with the aforementioned linearized plasmid, and then electrotransformed with a Biorad electrotransformer, wherein the voltage was 1500V, and the capacitance 50PF, resistance 4kg, add 0.5mmol / L cold sorbitol to the transformation cup, take 200μ1 and spread it on MD plate, culture at 30℃ until a single colony appears, and more than 1000 transformants are obtained as a result.
Embodiment 3
[0059] Example 3 Screening of recombinant strains of highly resistant Pichia methanolica
[0060] More than 1,000 transformants were successively spread on YPD plates containing 1mg / L, 2mg / L, 3mg / L, and 4mg / L of G418, and cultured at 28-30°C. As a result, 22 a transformant. The YPD preparation used is: 20 g of peptone, 10 g of yeast extract, and 20 g of glucose are dissolved in 0.9 L of water, and the volume is made up to 1 L with water, and then autoclaved.
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com