Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for detecting prawn virus by compound polymerase Chain -enzyme-linked immune reaction

An enzyme-linked immune reaction and polymerase chain technology, which is applied in the field of composite polymerase chain-enzyme-linked immune reaction detection of shrimp viruses, can solve problems such as no related reports on the composite detection technology of hepatopancreatic parvovirus, and achieves high sensitivity, simple process, Easy-to-use effects

Inactive Publication Date: 2006-03-01
WUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

From the current literature and patent search results, there are only reports of single virus or two kinds of virus composite polymerase chain reaction detection technology (Durand et al., 1996, Hasson et al., 1997, Lightner, 1996, Lightner et al., 1993, Nadala Jr.&Loh, 2000, Tsai et al., 2002), there is no relevant report on the combined detection technology of shrimp white spot syndrome virus, taura syndrome virus and hepatopancreatic parvovirus

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0030] Specific steps are as follows:

[0031] (1) Design and screening of specific oligonucleotide probes and amplification primers: According to the viral genome sequence design, the end-labeled biotin capture probes of shrimp white spot syndrome virus, taura syndrome virus and hepatopancreatic parvovirus The sequence is: biotin-ACTGTCACTGTTGCT; biotin-AGTTAGAACGGATAG; biotin-AGCAAGGTAGAGCTG, the upstream and downstream primer sequences for amplifying white spot syndrome virus are: TGATTTGTTGTGCCCTTTTG, ACGTAGGGTCGATGTTGGTG; the upstream and downstream sequences for amplifying hepatopancreatic parvovirus are: ACACAGCAATATGATCAAGAGAAA, GCACTGGCCATCGTATCTT ; The sequences of upstream and downstream primers for amplifying Taura syndrome virus are: TCGCTGCATGAGAAGGGTTAT, TTTTCGATGCAGATGGGTAAC. The lengths of the probes for detecting the amplified products of white spot syndrome virus, hepatopancreatic parvovirus and Taura syndrome virus are 331 base pairs, 194 base pairs and 236...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a compound polymerase chain-ELSA reaction prawn virus detecting method. Its steps: 1. design and synthesis of catch probe and amplifying primer; 2. extraction of tissue total nucleic acid; 3. labeling digoxigenin with compound polymerase chain reaction; 4. solid-phase cross; 5. enzyme linked coloration. It is adapted to diagnosis of white spot syndrome virus, taola syndrome virus and hepatopancreatic minute virus and monitoring of the health state of the prawn.

Description

technical field [0001] The invention belongs to the technical field of shrimp disease detection, and more specifically relates to a method for detecting prawn virus by a composite polymerase chain-enzyme-linked immunoreaction reaction, which is suitable for the diagnosis of prawn white spot syndrome virus, taura syndrome virus and hepatopancreas parvovirus pathogens . Background technique [0002] Shrimp white spot syndrome virus (White Spot Syndrome Virus, WSSV) is the main virus pathogen that caused the explosive death of prawn farming in Southeast Asia in the early 1990s. It can infect most prawn species, and the lethality rate is as high as 90-100%. The main symptom is that the body color of prawns is red, and white spots appear under the skin, carapace and appendages. It can also infect other freshwater and seawater crustaceans (Zhang Jianhong et al. 1994; Takahashi et al., 1994; Lo et al., 1996; Wang et al., 1995; Corbel et al., 2001). Tau...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): G01N33/53G01N33/535G01N33/569G01N33/68C12Q1/68
Inventor 石正丽袁军法
Owner WUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com