Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A promoter from Fusarium venetianus and a visual gene knockout screening method

A fusarium and promoter technology, applied in the field of genetic engineering, can solve the problems of laborious and laborious, low homologous recombination rate, etc., and achieve the effect of improving screening efficiency and efficient screening

Active Publication Date: 2022-06-24
TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Corresponding genetic transformation systems have been reported in Fusarium veniceum, but due to the low rate of homologous recombination (Royer, J.C.; Christianson, L.M.; Yoder, W.T.; Gambetta, G.A.; Klotz, A.V.; Morris, C.L.; Brody, H.; Otani, S. Deletion of the trichodiene synthase gene of Fusarium venenatum: two systems for repeated gene deletions. Fungal Genet. Biol. 1999, 28, 68-78.), leading to screening of target gene knockout transformations on primary transformation plates Body time is often laborious

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A promoter from Fusarium venetianus and a visual gene knockout screening method
  • A promoter from Fusarium venetianus and a visual gene knockout screening method
  • A promoter from Fusarium venetianus and a visual gene knockout screening method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Example 1 Construction of a high-efficiency Fusarium venetianus TB01 endogenous promoter regulated GFP gene expression vector

[0045] Through investigation and analysis, referring to the situation of promoters in other species, the endogenous promoters PgpdA, Pgla and Ptef of Fusarium venezia TB01 were studied and explored to screen out the strong endogenous promoters. The specific process is as follows:

[0046] The sequences of the endogenous promoters PgpdA (FVRRES_09878), Pgla (FVRRES_01380) and Ptef (FVRRES_13282) were amplified from the DNA genome of Fusarium venezia TB01 with primer pairs PgpdA1 / 2, Pgla1 / 2 and Ptef1 / 2, respectively. Pgfp-T1 / 2 amplified the GFP-Ttrpc sequence from the vector pK2-Ptrpc-GFP-Ttrpc. Subsequently, it was connected to the resistance backbone vector pK2-neo by homologous recombinase to obtain the corresponding endogenous promoter-regulated GFP gene expression vector. After transforming it into E. coli DH5α, a single colony was selecte...

Embodiment 2

[0053] Example 2 Protoplast transformation of Fusarium venezia TB01 with different promoters regulating GFP gene expression cassette

[0054] 1. Culture medium

[0055] YEPD: yeast powder 3g, peptone 10g, glucose 20g, make up to 1L; buffer for dissolving enzyme: 0.7 M sodium chloride; STC: 0.8 M sorbitol; 50 mM CaCl 2 , 50 mM Tris-HCl (Ph 8.0); SPTC: STC containing 40% PEG6000; regeneration medium: yeast extract 1g, tryptone 1g, sucrose 274g, agarose 10g, constant volume 1L; screening medium: glucose 30g , Yeast powder 6g, agar powder 15g, dilute to 1L.

[0056] 2. Primers

[0057] PpKLB1:GGTGGCAGGATATATTGTGG (SEQ ID NO. 8);

[0058] PpKLB2: TTGGTTGGTCAAGTCCTGGT (SEQ ID NO. 9).

[0059] 3. Fragment Amplification Procedure

[0060] 98℃ 10s, 55℃ 15s, 72℃ 3mins; 35 cycles (primestar, TaKaRa)

[0061] 4. Experimental method

[0062] 1) Amplification of transformed fragments

[0063] The fragment PgpdA::GFP-neo was amplified from pK2-Promoter::GFP-neo by designing the prime...

Embodiment 3

[0077] Example 3 Construction of a visual gene knockout transformant screening vector

[0078] The left and right arm sequences of the chitin synthase gene knockout region were amplified from the DNA genome of Fusarium venezia TB01 with primer pairs a few left arm 1 / 2 and a few right arm 1 / 2, respectively, and sequenced by seamless cloning Linked to both sides of the resistance gene expression cassette of the vector pK2-neo; then knocked out 1 / 2 of the cassette from the constructed pK2-Chs with primer pairs upstream -neo-Chs downstream Chs amplified in the vector upstream -neo-Chs downstream fragment, and ligated it into the backbone vector pK2-PgpdA::GFP by homologous recombinase (US Everbright) to obtain pK2-PgpdA::GFP-Chs upstream -neo-Chs downstream , after transformation of E. coli DH5α, a single colony was selected for Pme I and Xba I double-enzyme digestion verification, select the correct transformants.

[0079] Table 3 Construction of visual gene knockout tran...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a high-efficiency endogenous strong promoter derived from Fusarium veniceum, and a screening method for visual gene knockout transformants suitable for Fusarium venetianum. Using this method, if the target gene fragment is randomly inserted into the genome of Fusarium venezia, the colony will show fluorescence; if the target fragment achieves homologous knockout of the target gene, the colony will not emit fluorescence. Therefore, the vast majority of randomly inserted transformants (with fluorescence) can be easily excluded, and the transformants without fluorescence can be verified by PCR specificity. The results show that the screening efficiency of knockout transformants can be significantly improved. The screening system provided by the invention realizes convenient, rapid and efficient screening to knockout transformants from strains with low homologous recombination rate.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a promoter derived from Fusarium venetianus and a method for a visual gene knockout screening system. Background technique [0002] Fusarium venezia is an industrial strain screened from more than 3,000 fungi that can be used for fermentative production of mycelin. Compared with the single-cell protein, the mycelial protein produced by the fermentation of this strain is more delicious, has a meat-like tissue structure, and can provide a good nutritional balance, including low fat content, complete amino acid types, rich in trace elements, vitamins and benefits. Edible crude fiber for human gastrointestinal motility. In addition, Fusarium venezia mycelial protein also has very good safety, and has obtained the marketing license of food raw materials in 18 countries around the world. Therefore, it has the potential to partially or completely replace animal-based and plant-based...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12N15/80C12N15/65C12N1/15C12R1/77
CPCC07K14/37C12N15/80C12N15/65
Inventor 马延和童胜李德茂王钦宏陈吴西孙媛霞
Owner TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com