Method for producing 5 '-cytidine monophosphate
A cytidine and uridine kinase technology, applied in the fields of genetic engineering and microbial engineering, can solve the problem of low yield and achieve the effects of enhanced transformation, favorable separation and purification, and high concentration
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Embodiment 1: The construction method of the recombinant Escherichia coli that is used to produce 5'-cytidylic acid
[0028] (1) Construction of recombinant plasmid pRSFDuet- for overexpression of uridine kinase gene udk
[0029] Using primers udk-FW: CATGCCATGGGCactgatcagtctcatcagtg (SEQ ID NO: 7) and udk-RS: CGGGATCCTTATTCAAAGAACTGACTT (SEQ ID NO: 8), the E. coli genome was used as a template for PCR amplification to obtain udk The target fragment (the nucleotide sequence is shown in SEQ ID NO: 5, and the amino acid sequence of the encoded enzyme is shown in SEQ ID NO: 6). PCR amplification conditions: pre-denaturation at 98°C for 5 min; denaturation at 95°C for 30 s; annealing at 55°C for 30 s; extension at 72°C for 1 min; set cycle 29 times; extension at 72°C for 10 min; final extension at 16°C insulation. PCR amplification system: 5×PSbuffer 20 μL, dNTP 10 μL, upstream / downstream primers (10 μmol L -1 ) 2 μL, template 1 μL, enzyme 1 μL, water 66 μL. restrict...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap