Double-target SARS-CoV-2 virus nucleic acid detection primer group, application and fluorescent kit

A technology for detecting primers and viral nucleic acids, applied in DNA/RNA fragments, recombinant DNA technology, biochemical equipment and methods, etc., can solve problems such as hidden safety hazards, complex judgment process, secondary pollution, etc., to prevent secondary pollution. , high sensitivity, ensure the effect of safety

Pending Publication Date: 2022-02-22
SOUTH CHINA UNIV OF TECH
View PDF9 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The patent is detected by fluorescence in situ hybridization technology, the judgment process is complicated and not intuitive
[0005] For another example, the patent CN111270021A discloses a primer pair, probe, composition, kit and application for detecting the new coronavirus SARS-CoV-2. It is necessary to extract nucleic acid from the sample, which is likely to cause secondary pollution and other problems. There are security risks

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Double-target SARS-CoV-2 virus nucleic acid detection primer group, application and fluorescent kit
  • Double-target SARS-CoV-2 virus nucleic acid detection primer group, application and fluorescent kit
  • Double-target SARS-CoV-2 virus nucleic acid detection primer group, application and fluorescent kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] The embodiment of the present invention provides a dual-target SARS-CoV-2 viral nucleic acid detection primer set, including an N gene primer set and an S gene primer set;

[0056] The N gene primer set includes a pair of outer primers F3-1 and B3-1, a pair of inner primers FIP-1 and BIP-1, and a pair of loop primers LF-1 and LB-1;

[0057] The nucleotide sequence SEQ ID No of said F3-1, B3-1, FIP-1, BIP-1, LF-1, LB-1 is as follows:

[0058] F3-1: CTAGGTTTCAAACTTTACTTGC;

[0059] B3-1: CCTTTTTCTACAGTGAAGGATT;

[0060] FIP-1: ACCCACATAATAAGCTGCAGCA-GTTATTTGACTCCTGGTGATT;

[0061] BIP-1: ATGAAAATGGAACCATTACAGATGC-CAACGTACACTTTGTTTCTGA;

[0062] LF-1: CCAGCTGTCCAACCTGAAGA;

[0063] LB-1: ACTGTGCACTTGACCCTCTC.

Embodiment 2

[0065] The embodiment of the present invention provides a dual-target SARS-CoV-2 viral nucleic acid detection primer set, including an N gene primer set and an S gene primer set;

[0066] The S gene primer set includes a pair of outer primers F3-2 and B3-2, a pair of inner primers FIP-2 and BIP-2, and a pair of loop primers LF-2 and LB-2;

[0067] The nucleotide sequence SEQ ID No of said F3-2, B3-2, FIP-2, BIP-2, LF-2, LB-2 is as follows:

[0068] F3-2: CACCCGCAATCCTGCTAAC;

[0069] B3-2: CCAGCCATTCTAGCAGGAGA;

[0070] FIP-2: TGCTCCCTTCTGCGTAGAAGC-GCTGCAATCGTGCTACAACT;

[0071] BIP-2: GGCGGCAGTCAAGCCTCTTC-CCTACTGCTGCCTGGAGTT;

[0072] LF-2: TGGCAATGTTGTTCCTTGAGG;

[0073] LB-2: ATCACGTAGTCGCAACAGTTC.

Embodiment 3

[0075] The embodiment of the present invention provides a one-pot RT-LAMP fluorescence detection kit for detecting SARS-CoV-2 virus. The kit is composed of reaction premix A, reaction premix B, positive quality control, and negative control. Specifically, using the kit of this embodiment, the 25 μL reaction system contains the following materials: 5 μL of the sample to be tested, 3 μL of the reaction master mix A (4U of Bst DNA large fragment polymerase, 8U of AMV reverse transcriptase, 0.5 μL of SYBR green I fluorescent dye (1000×), 17 μL reaction premix B (primer set 2.8 μL, dNTP 1.0 mM, betaine 1.2 mM, magnesium sulfate 12 mM, volume fraction 12% formamide solution, DEPC water to make up to 17 μL).

[0076] The primer set is the dual-target SARS-CoV-2 viral nucleic acid detection primer set described in Example 1 and Example 2, and the nucleotide sequence is as shown in SEQ ID No1-12. Wherein, the concentration ratio of the N gene primer set and the S gene primer set is 1:1...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a double-target SARS-CoV-2 virus nucleic acid detection primer group, application and a fluorescent kit, and relates to the technical field of virus nucleic acid detection methods. The double-target specific nucleic acid detection primer group is designed for a conserved region of the SARS-CoV-2 virus by selecting double gene sequences of the SARS-CoV-2 virus nucleocapsid protein N gene and the spike protein S gene, and the SARS-CoV-2 virus can be specifically detected. The invention further provides a one-pot RT-LAMP fluorescence detection kit for detecting the SARS-CoV-2 virus, a throat swab and other samples, nucleic acid extraction is not needed, an amplification curve is observed through a fluorescence amplification instrument under the isothermal condition of 65 DEG C, the SARS-CoV-2 virus can be accurately detected within 30 minutes, and virus-result detection is directly achieved. The fluorescent kit adopts a double-primer group design, is strong in specificity, high in sensitivity, free of cross reaction, capable of rapidly and accurately screening the SARS-CoV-2 virus, simple to operate and high in safety; the detection result is visual, the judgment operation is simple, and the method has good application advantages in the field of viral nucleic acid detection.

Description

technical field [0001] The invention relates to the technical field of viral nucleic acid detection methods, in particular to a dual-target SARS-CoV-2 viral nucleic acid detection primer set, a one-pot RT-LAMP fluorescence detection kit for detecting SARS-CoV-2 virus and its application. Background technique [0002] Novel coronavirus pneumonia (COVID-19) is an acute infectious pneumonia caused by a new type of coronavirus (SARS-CoV-2). The reproduction number R0 is 3.8; the current global new crown pneumonia has caused more than 13 million infected people and 570,000 infected people to die. [0003] In the process of epidemic prevention and control, real-time fluorescent quantitative RNA reverse transcription and cDNA polymerase chain amplification detection technology RT-qPCR is the main means of virus detection, but this detection technology has long detection time and complicated operation of equipment And other problems, resulting in the current clinical application of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/6844C12N15/11
CPCC12Q1/701C12Q1/6844C12Q2521/107C12Q2563/107Y02A50/30
Inventor 张雷王小明李俊敏李杉
Owner SOUTH CHINA UNIV OF TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap