Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of miR-302b-3p as anti-tumor marker of oral squamous cell carcinoma

A technology for squamous cell carcinoma and oral cavity, which is applied in the field of tumor diagnosis and treatment, can solve the problems that miR-302b-3p and OSCC invasiveness or migration have not been reported and have not been fully confirmed, and achieve rich drug selection, Effect of delaying invasion and/or migration

Pending Publication Date: 2021-11-02
SICHUAN UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Another study showed that miR-302b-3p was contained in salivary exosomes of OSCC patients, but not in salivary exosomes of healthy people (Salivary extracellular vesicle-associated miRNAs as potential biomarkers in oral squamous cell carcinoma. BMC Cancer.2018Apr18; 18(1):439.), it can be inferred that miR-302b-3p may be an OSCC tumor-promoting factor, and the higher the expression of miR-302b-3p in oral cells, the possibility of OSCC higher, but this view has not been fully confirmed
[0005] In addition, there is no report on the relationship between miR-302b-3p and OSCC invasiveness or migration

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of miR-302b-3p as anti-tumor marker of oral squamous cell carcinoma
  • Application of miR-302b-3p as anti-tumor marker of oral squamous cell carcinoma
  • Application of miR-302b-3p as anti-tumor marker of oral squamous cell carcinoma

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1 The relationship between the invasion and migration ability of OSCC cell lines and the expression level of miR-302b-3p

[0029] Using eukaryotic cell transfection technology, miR-302b-3p-mimic [sense strand: UAAGUGCUUCCAUGUUUUAGUAG (SEQ ID NO.1); antisense strand CUACUAAAACAUGGAAGCACUUA (SEQ ID NO.2)], miR-302b-3p-off [CUACUAAAAACAUGGAAGCACUUA (SEQ ID NO.3)] or random miRNA mimic [ie NC-mimic; micrON mimic NC sequence sense strand: UUUGUACUACACAAAAGUACUG (SEQ ID NO.4), antisense strand: CAGUACUUUUGUGUAGUACAAA (SEQ ID NO.5); micrOFF inhibitor NC Sequence: CAGUACUUUUGUGUAGUACAA (SEQ ID NO.6)] OSCC cell lines HSC-3, HSC-4, UM1 and UM2 were transfected respectively. Use Transwell invasion assay and migration assay to detect migration and invasion before and after transfection. In addition, cellular RNA was extracted, and the expression of miR-302b-3p was detected by qRT-PCR.

[0030] The specific operation method is as follows:

[0031] 1. Cell RNA extraction a...

Embodiment 2

[0036] Embodiment 2 Nude mouse OSCC buccal xenograft tumor animal model metastasis experiment

[0037] The method is as follows: ① Preparation of cell suspension: a. Luciferase gene (Luciferase) labeled cells: the highly invasive HSC-3 cell line with in vitro tumorigenic ability was used to label the cells with luciferase (Luciferase) gene. The blank group is the normal untreated luciferase gene-marked HSC-3 cell line, the control group is the luciferase gene-marked HSC-3 cell line overexpressing NC mimic, and the experimental group is the fluorescent cell line overexpressing miR-302b-3p. Sulfase gene labeled HSC-3 cell line. Cultivate until the exponential growth phase with good growth status. Collect the cells and prepare a serum-free and antibiotic-free medium (DMEM) to resuspend the cell solution, count and adjust the cell concentration to 1×10 7 / mL. ②Put the Matri-gel glue in a 4-degree refrigerator to melt in advance. The above cell suspension was mixed with Matri-g...

Embodiment 3

[0040] Embodiment 3 verification target gene

[0041] According to software prediction, it was found that FZD6 is the target gene of miR-302b-3p, and its target recognition mode is as follows: image 3 As shown in A. The purpose of this example is to verify whether the gene is the target gene.

[0042] 1. Validation of dual luciferase reporter gene system

[0043] Method: HEK-293T cells were seeded in a 96-well plate, so that the density of transfected cells reached 1×10 7 / mL. The miR-302b-3p overexpression vector and psiCHECK-2-Report-FZD6-3'UTR vector were co-transfected into 293T cells, and the miR-302b-3p overexpression vector and psiCHECK-2-Report-FZD6- 3'UTR mut vector or psiCHECK-2-Report empty vector was used as control. Each group was co-transfected with jellyfish luciferase (PRL-TK) as an internal reference, and the transfection reagent was invitrogenlipofectamine 2000. After 48 hours of transfection, the green fluorescent light was observed under a fluorescen...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of miR-302b-3p as an anti-tumor marker of oral squamous cell carcinoma, and belongs to the field of tumor diagnosis and treatment. The application is divided into two aspects: firstly, the miR-302b-3p detection reagent is used for preparing a diagnostic kit for the invasiveness and / or migration of the oral squamous cell carcinoma, and secondly, the miR-302b-3p or a miR-302b-3p precursor is used as an active ingredient for preparing a medicine for delaying the invasion and / or migration of the oral squamous cell carcinoma. The application provides a new direction for diagnosis and treatment of oral squamous cell carcinoma, and has a very good application prospect.

Description

technical field [0001] The invention belongs to the field of tumor diagnosis and treatment. Background technique [0002] Oral squamous cell carcinoma (OSCC), referred to as oral squamous cell carcinoma, accounts for about 90% of oral and maxillofacial malignant epithelial tumors. rate and poor prognosis. OSCC cells have a high ability of invasion and migration, and are prone to invade surrounding tissues and metastasize to local lymph nodes in the early stage of the disease, and then can metastasize to distant organs through lymphatic vessels and blood vessels, resulting in metastatic tumors. Based on the above characteristics, the treatment of OSCC patients is often not timely, the long-term effect of the existing treatment methods is still unsatisfactory, the mortality rate is high, and the five-year survival rate is only about 50%. Therefore, it is imminent to find key molecules that prevent oral mucosal carcinogenesis and inhibit OSCC metastasis. Early attention to t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K48/00A61K31/7088A61P35/00A61P35/04C12Q1/6886
CPCA61K31/7088A61P35/00A61P35/04C12Q1/6886C12Q2600/178C12Q2600/118
Inventor 陈谦明李敬王冏珂刘佳佳孙思露曾昕
Owner SICHUAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com