Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

FcRGA1 gene related to disease resistance of citrus plants, primer pair, silence vector and application

A citrus, primer pair technology, applied in the field of gene editing, can solve the problems of resistant breeding, male abortion, stunted growth, etc.

Active Publication Date: 2021-09-14
GANNAN NORMAL UNIV
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Since most citrus varieties are polyembryonic, the development of asexual embryos is better than that of sexual embryos, causing the latter to be stunted. In addition, female and / or male abortions of some varieties make it difficult to carry out resistance breeding through sexual hybridization

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • FcRGA1 gene related to disease resistance of citrus plants, primer pair, silence vector and application
  • FcRGA1 gene related to disease resistance of citrus plants, primer pair, silence vector and application
  • FcRGA1 gene related to disease resistance of citrus plants, primer pair, silence vector and application

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0030] The present invention provides a method for preparing the above-mentioned silencing carrier, comprising the following steps:

[0031] Insert the specific fragment of FcRGA1 gene between the BamHI and SmaI restriction sites of pTRV2 to obtain the silencing vector;

[0032] The nucleotide sequence of the specific fragment of the FcRGA1 gene is shown in SEQ ID No:5.

[0033] In the present invention, the specific fragment of the FcRGA1 gene is connected between the two restriction sites of BamHI and SmaI of pTRV2 to obtain a silencing vector, that is, the FcRGA1-pTRV2 vector. 在本发明中,所述FcRGA1基因的特异性片段的核苷酸序列SEQ ID No:5所示:GGTTTCAGGGAATGGTCAGACGAAAGTGCAGTAAAGCGTTACACTTCGATCGTCTTACATGATGTCAGGACTAATGTGCTTCCTGAAGTAGTGGAATGTCCTCAACTCAAACTTCTTTTTATAAGTGCGGATAAGGAATCTTCATCATTAACCATTCCAAACAATTTTTTCAAGAGGATGATACAGGTCAGAGTTATAAACTTGACTTACATGAATCTACTGTCACTGCCTTCAACACTTGGTTTTCTGTTAAACCTTCGAGCACTGAGTTTGTGTTATTGCAAATTGCTAGATATAAGTGTTATAGGAGGCTTGAATAAACTAGAAATCCTTTGTTTAAGAGGCTCTGACATTAAGCAGCTG...

Embodiment 1

[0041] Acquisition of the FcRGA1 gene

[0042] 1. RNA extraction:

[0043] The RNA extraction method in this experiment refers to the Easy Plant RNA Extraction Kit kit from Zhejiang Yiside Biotechnology Co., Ltd., and the extraction method is operated according to the instructions. The specific steps are as follows:

[0044] (1) Take 100-200 mg of kumquat leaf tissue and grind it into powder in liquid nitrogen, put it into a 2 mL RNase-free centrifuge tube frozen in liquid nitrogen, add 1 mL of Buffer PR1, and vortex for 1 min to lyse the cells.

[0045] (2) Add 200 μL of nucleic acid extraction solution (24:1 chloroform isoamyl alcohol), vortex fully, and centrifuge at 13,000 g for 5 min at 4°C.

[0046] (3) Pipette the supernatant into a new 2mL RNase free centrifuge tube, and add an equal volume of absolute ethanol. Mix well by inverting, transfer the mixture to a Hipure RNA adsorption column set in a 2mL collection tube, and centrifuge at 13000g for 1min at 4°C.

[0047...

Embodiment 2

[0078] Analysis of Induced Expression of FcRGA1 Gene by Canker sores

[0079] (1) Kumquat material: Kumquat seeds are used to plant seedlings, which can be inoculated with canker bacteria (manufacturer: China Microorganism Collection Center, article number: bio-33588) when they are about 3 months old.

[0080] (2) Activation of canker strains: take out the preserved canker strains from -80°C before inoculation, activate them by streaking on NA solid medium (manufacturer: Beijing Land Bridge Technology Co., Ltd., article number: CM107-01), and cultivate them in an incubator at 28°C After 2 days, single clones were picked, and continued to be streaked and expanded in the new NA medium. After 2 days, the Xcc cells were scraped and diluted with sterile water to prepare 5×10 7 cfu / mL bacterial suspension.

[0081] (3) Kumquat leaf inoculation with canker bacteria: use a small injection syringe (1 mL) to inject the prepared bacterial suspension into the back of the kumquat leaf, an...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of gene editing, in particular to an FcRGA1 gene related to disease resistance of citrus plants, a primer pair, a silence vector and application. The invention provides the FcRGA1 gene related to disease resistance of the citrus plants. A nucleotide sequence of the FcRGA1 gene comprises a sequence as shown in SEQ ID No: 1. By silencing the FcRGA1 gene, the resistance of the citrus plants on a citrus bacterial canker disease is remarkably reduced, which indicates that the gene can be used for citrus bacterial canker disease resistant breeding of the citrus plants.

Description

technical field [0001] The invention relates to the field of gene editing, in particular to an FcRGA1 gene related to citrus plant disease resistance, a pair of primers, a silencing vector and an application. Background technique [0002] Citrus is the most important fruit tree in southern China. After the founding of New China, the citrus industry has developed rapidly and has become an important pillar of the agricultural economic industry in China's main citrus producing areas. made a huge contribution. But canker disease (Citrus Bacterial Canker Disease, CBCD) has caused a very serious threat to the development of my country's citrus industry. Therefore, canker research is the top priority of citrus science and technology work. [0003] Based on this, cultivating citrus varieties with canker resistance will be beneficial to the sustainable and stable development of the citrus industry. Since most citrus varieties are polyembryonic, the development of asexual embryos i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C07K14/415C12N15/82A01H5/00A01H6/78
CPCC07K14/415C12N15/8281
Inventor 戴文珊王敏
Owner GANNAN NORMAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com