Application of DNA-RNA hybrid double-stranded specific conjugate in promotion of nucleic acid replication and detection of novel coronavirus
An RNA primer and specific technology, applied in the field of DNA-RNA hybrid double-strand specific conjugates, can solve the problems that the application has not yet been developed and applied
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Example 1: Several DNA-RNA hybrid double-strand specific conjugates are used for the detection of novel coronavirus (SARS-CoV-2) oropharyngeal swab samples:
[0039] The reverse transcription and amplification reactions described in this embodiment and other embodiments of the present invention use artificially synthesized primers and probes with the following sequences.
[0040] Novel coronavirus detection, corresponding sequence NC_045512.2;
[0041] N gene primer sequence:
[0042] F1: AAATGTCTGATAATGGACCCCAA, SEQ ID No.1 (the corresponding position in the gene is 28274-28294);
[0043] R1: GCCGACGTTGTTTTGATCGC, SEQ ID No.2 (the position in the corresponding gene is 28378-28397);
[0044] The probe sequence is:
[0045] P1: FAM-CTGAG GGTCCACCAAACGTAATGC-BHQ, SEQ ID No. 3 (corresponding to positions 28314-28337 in the gene).
[0046] The sequence of the E gene primer is:
[0047] F2: AGTTACACTAGCCATCCTT, SEQ ID No.4 (corresponding to 26328-26346 in the gene);
...
Embodiment 2
[0064] Example 2: DNA-RNA hybrid double-strand specific conjugates are used for DNA detection:
[0065] The following several DNA-RNA hybrid double-strand specific conjugates described in the present invention (anti-DNA-RNA hybrid double-strand mouse antibody (such as Absolute Antibody Ab01137-2.0), hybridoma monoclonal antibody HB8730 (such as QIAGEN 5198-1220), anti-DNA-RNA hybrid double-stranded rabbit antibody (such as Absolute Antibody Ab01137-23.0) is used for the human ACTB gene detection of DNA template. The RT-PCR reaction setting is the same as that of Example 1.
[0066] The method of comparison is to use human-derived genomic DNA samples (about 2ng / μL) for detection, and compare the Ct values of RT-PCR amplification of the samples in the group containing three conjugates and the group without conjugates. Each sample was tested in triplicate to evaluate the effect of different heterozygous double-strand specific conjugates on the RT-PCR detection effect of DNA tem...
Embodiment 3
[0071] Example 3: DNA-RNA hybrid double-strand specific conjugates enhance human mRNA reverse transcription:
[0072] The following several DNA-RNA hybrid double-strand specific conjugates described in the present invention (anti-DNA-RNA hybrid double-strand mouse antibody (such as Absolute Antibody Ab01137-2.0), hybridoma monoclonal antibody HB8730 (such as QIAGEN 5198-1220), anti-DNA-RNA hybrid double-stranded rabbit antibody (such as Absolute Antibody Ab01137-23.0) is used to enhance the efficiency of mRNA reverse transcription.
[0073] The comparison method is to use human total RNA samples (remove DNA) and synthesize three poly(dT) primers of different lengths: dT8 / dT12 / dT16 (8 / 12 / 16 bases in length, respectively) for total mRNA reverse transcription , and then detect the ACTB reverse transcription cDNA. Through the comparison of the Ct value of PCR amplification of the reverse transcription product in the three groups containing the conjugate group and the non-conjugat...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com