Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

bFGF mesenchymal stem cell exosome as well as preparation method and application thereof

A technology of mesenchymal stem cells and exosomes, applied in the field of bFGF mesenchymal stem cell exosomes and its preparation, can solve the problems of low bFGF content, low specificity, and inability to repair tissues well

Active Publication Date: 2021-07-06
广州远想生物科技股份有限公司
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The bFGF in the exosomes secreted by mesenchymal stem cells is mainly in the membrane. This type of exosomes is delivered to the damaged tissue and acts on a variety of cells at the site. Although it can play a role in regulating the physiological functions of cells, but Since the content of bFGF carried in the exosomes secreted by mesenchymal stem cells is low, it cannot target myofibroblasts and dermal fibroblasts in the damaged area, and the specificity is low, so it is not very good. Play a role in repairing tissue and reducing scar formation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • bFGF mesenchymal stem cell exosome as well as preparation method and application thereof
  • bFGF mesenchymal stem cell exosome as well as preparation method and application thereof
  • bFGF mesenchymal stem cell exosome as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Example 1 Construction of a slow viral vector

[0049] 1. Designing the sequence of BFGF fusion proteins, using the signal peptide of the mesenchymal stem cell surface label CD44 as a signal peptide and transmembrane region of the fusion protein, and the Linker connecting the target protein and the transmembrane region selects the flexible chain. Signal peptide, destination gene BFGF, Linker, sequence of transmembrane regions as follows: N-terminal signal peptide:

[0050] Atggacaagtttggtgggcacgcagcctggggctctctgcctcgtgccgct gagcctggcg (SEQ IDNO.1)

[0051] Nucleotide sequence of protein BFGF:

[0052] CTGGTGGGTGTGGGGGGTGGAGATGTAGAAGATGTGACGCCGCGGCCCGGCGGGTGCCAGATTAGCGGACGCGGTGCCCGCGGTTGCAACGGGATCCCGGGCGCTGCAGCTTGGGAGGCGGCTCTCCCCAGGCGGCGTCCGCGGAGACACCCATCCGTGAACCCCAGGTCCCGGGCCGCCGGCTCGCCGCGCACCAGGGGCCGGCGGACAGAAGAGCGGCCGAGCGGCTCGAGGCTGGGGGACCGCGGGCGCGGCCGCGCGCTGCCGGGCGGGAGGCTGGGGGGCCGGGGCCGGGGCCGTGCCCCGGAGCGGGTCGGAGGCCGGGGCCGGGGCCGGGGGACGGCGGCTCCCCGCGCGGCTCCAGCGGCTCGGGGATCCC...

Embodiment 2

[0066] Characterization of 2 mesenchymal stem cell infectious virus

[0067]1. Slim virus infection of mesenchymal stem cells, 950 μL 1 × HBs to EP tube, add 10 ug BFGF plasmid, mix, slowly add 50 μl of CaCl2 solution (2M), and then stand for 20 min, add to cell state Good density of about 60% -70% in 293T cells, gently mix, add 37 ° C, 5% CO 2 After 12 h, after 12 h, the replacement medium was complete medium for 10 ml of 30% FBS, and the cell was taken after 48 h, and the cell was concentrated at room temperature for 15 min. Take it to a mesenchymal stem cell growth to 50% -60%, adding a final concentration of 8 ug / ml, mix, add 37 ° C, 5% CO 2 The cell incubator and 12h were replaced with 10% FBS fully medium.

[0068] 2. BFGF mesenchymal stem cell screening, in an infected masonhy stem cell, adding final concentrations of 2 ug / ml puromycin, surviving mesenchymal stem cells are considered to express BFGF.

[0069] 3. In the mRNA level detection, the BFGF expression of mesenc...

Embodiment 3

[0081] Example 3 Characterization of an exosomental body of mesenchymal stem cells from BFGF fusion protein genes

[0082] 1. Extract wild-type mesenchymal stem cells, and BFGF growth factors, meticulotic stem cells, and integrated stem cells that integrate BFGF fusion protein gene (BFGF mesenchymal stem cells). Three cells were cultured with 10% FBS, and after the cell density reached 70%, it was replaced with 0.5% EV Free FBS medium. After 48h, the cell culture was harvested, centrifuged 500 × g, 10 min, and , Centrifugation 2000 × g, 20 min, then take the clear, centrifuge 1000 × g, 40min, take the supernatant, extra speed centrifugation 100000 × g, 90min, the precipitate, the amount of PBS is resuspended, the ultracentricant centrifuge 100000 × g, 90 min, collect precipitation , A small amount of PBS is resuspended, stored in a low temperature refrigerator. All of the above centrifugal operations were carried out under conditions of 4 ° C.

[0083] 2. TEM characterizes the out...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a bFGF mesenchymal stem cell exosome as well as a preparation method and application thereof. The bFGF mesenchymal stem cell exosome is secreted by mesenchymal stem cells and can express bFGF fusion protein on a mesenchymal stem cell membrane. The bFGF is expressed on the membranes of the mesenchymal stem cells and the mesenchymal stem cell exosome in the form of fusion protein for the first time, a large amount of bFGF protein can be expressed, the specific targeting property of the mesenchymal stem cell exosome can be enhanced, the wound repairing effect is remarkably improved, and scar formation is reduced. The invention provides a novel safe and efficient medicine or a medical preparation or a medical beauty product for promoting tissue repair.

Description

Technical field [0001] The present invention relates to the field of biopharmaceutical technology, and more particularly to BFGF mesenchymal stem cell exosomes and preparation methods and applications thereof. Background technique [0002] The skin is the largest organ of the human body, which is a natural barrier against the external pathogens. Under acute and chronic skin damage, burns, high blood pressure, severe diabetes, etc., the integrity of the skin is destroyed, affecting the skin's barrier function, increasing the risk of infection And causing pain and tactile sensing decline, so the healing of the rapid normally normally trace is important to the body. Adult wounds are generally healing through fibrification and scar formation, and the physiological end of healing is the formation of scars. Many wounds that cannot be healed, long-term remaining in chronic inflammation, and it is easy to cause fatty scars or scars, affect the normal physiology of skin tissue. Features. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N5/10C12N15/867C12N15/62A61K35/28A61P17/00A61P17/02A61K8/99A61Q19/00
CPCA61K8/99A61K35/28A61Q19/00A61P17/00A61P17/02C07K14/503C07K14/70585C07K2319/02C07K2319/03C12N5/0662C12N15/86C12N2510/00C12N2740/15043C12N2800/107
Inventor 陈玉容周晗邹衡芳姚基祥廖勇
Owner 广州远想生物科技股份有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com