bFGF mesenchymal stem cell exosome as well as preparation method and application thereof
A technology of mesenchymal stem cells and exosomes, applied in the field of bFGF mesenchymal stem cell exosomes and its preparation, can solve the problems of low bFGF content, low specificity, and inability to repair tissues well
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0048] Example 1 Construction of a slow viral vector
[0049] 1. Designing the sequence of BFGF fusion proteins, using the signal peptide of the mesenchymal stem cell surface label CD44 as a signal peptide and transmembrane region of the fusion protein, and the Linker connecting the target protein and the transmembrane region selects the flexible chain. Signal peptide, destination gene BFGF, Linker, sequence of transmembrane regions as follows: N-terminal signal peptide:
[0050] Atggacaagtttggtgggcacgcagcctggggctctctgcctcgtgccgct gagcctggcg (SEQ IDNO.1)
[0051] Nucleotide sequence of protein BFGF:
[0052] CTGGTGGGTGTGGGGGGTGGAGATGTAGAAGATGTGACGCCGCGGCCCGGCGGGTGCCAGATTAGCGGACGCGGTGCCCGCGGTTGCAACGGGATCCCGGGCGCTGCAGCTTGGGAGGCGGCTCTCCCCAGGCGGCGTCCGCGGAGACACCCATCCGTGAACCCCAGGTCCCGGGCCGCCGGCTCGCCGCGCACCAGGGGCCGGCGGACAGAAGAGCGGCCGAGCGGCTCGAGGCTGGGGGACCGCGGGCGCGGCCGCGCGCTGCCGGGCGGGAGGCTGGGGGGCCGGGGCCGGGGCCGTGCCCCGGAGCGGGTCGGAGGCCGGGGCCGGGGCCGGGGGACGGCGGCTCCCCGCGCGGCTCCAGCGGCTCGGGGATCCC...
Embodiment 2
[0066] Characterization of 2 mesenchymal stem cell infectious virus
[0067]1. Slim virus infection of mesenchymal stem cells, 950 μL 1 × HBs to EP tube, add 10 ug BFGF plasmid, mix, slowly add 50 μl of CaCl2 solution (2M), and then stand for 20 min, add to cell state Good density of about 60% -70% in 293T cells, gently mix, add 37 ° C, 5% CO 2 After 12 h, after 12 h, the replacement medium was complete medium for 10 ml of 30% FBS, and the cell was taken after 48 h, and the cell was concentrated at room temperature for 15 min. Take it to a mesenchymal stem cell growth to 50% -60%, adding a final concentration of 8 ug / ml, mix, add 37 ° C, 5% CO 2 The cell incubator and 12h were replaced with 10% FBS fully medium.
[0068] 2. BFGF mesenchymal stem cell screening, in an infected masonhy stem cell, adding final concentrations of 2 ug / ml puromycin, surviving mesenchymal stem cells are considered to express BFGF.
[0069] 3. In the mRNA level detection, the BFGF expression of mesenc...
Embodiment 3
[0081] Example 3 Characterization of an exosomental body of mesenchymal stem cells from BFGF fusion protein genes
[0082] 1. Extract wild-type mesenchymal stem cells, and BFGF growth factors, meticulotic stem cells, and integrated stem cells that integrate BFGF fusion protein gene (BFGF mesenchymal stem cells). Three cells were cultured with 10% FBS, and after the cell density reached 70%, it was replaced with 0.5% EV Free FBS medium. After 48h, the cell culture was harvested, centrifuged 500 × g, 10 min, and , Centrifugation 2000 × g, 20 min, then take the clear, centrifuge 1000 × g, 40min, take the supernatant, extra speed centrifugation 100000 × g, 90min, the precipitate, the amount of PBS is resuspended, the ultracentricant centrifuge 100000 × g, 90 min, collect precipitation , A small amount of PBS is resuspended, stored in a low temperature refrigerator. All of the above centrifugal operations were carried out under conditions of 4 ° C.
[0083] 2. TEM characterizes the out...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com