Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

BFGF mesenchymal stem cell exosomes and preparation method and application thereof

A technology of mesenchymal stem cells and exosomes, applied in the field of bFGF mesenchymal stem cell exosomes and its preparation, can solve the problems of low specificity, low bFGF content, and inability to repair tissues well

Active Publication Date: 2021-11-19
广州远想生物科技股份有限公司
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The bFGF in the exosomes secreted by mesenchymal stem cells is mainly in the membrane. This type of exosomes is delivered to the damaged tissue and acts on a variety of cells at the site. Although it can play a role in regulating the physiological functions of cells, but Since the content of bFGF carried in the exosomes secreted by mesenchymal stem cells is low, it cannot target myofibroblasts and dermal fibroblasts in the damaged area, and the specificity is low, so it is not very good. Play a role in repairing tissue and reducing scar formation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • BFGF mesenchymal stem cell exosomes and preparation method and application thereof
  • BFGF mesenchymal stem cell exosomes and preparation method and application thereof
  • BFGF mesenchymal stem cell exosomes and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] The construction of embodiment 1 lentiviral vector

[0049] 1. Design the sequence of the bFGF fusion protein, use the signal peptide and transmembrane region of the mesenchymal stem cell surface marker CD44 as the signal peptide and transmembrane region of the fusion protein, and select the flexible chain for the linker connecting the target protein and the transmembrane region. The signal peptide, target gene bFGF, linker, and the sequence of the transmembrane region are as follows: N-terminal signal peptide:

[0050] ATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGCCGCTGAGCCTGGCG (SEQ ID NO. 1)

[0051] The nucleotide sequence of the target protein bFGF:

[0052] CTGGTGGGTGTGGGGGGTGGAGATGTAGAAGATGTGACGCCGCGGCCCGGCGGGTGCCAGATTAGCGGACGCGGTGCCCGCGGTTGCAACGGGATCCCGGGCGCTGCAGCTTGGGAGGCGGCTCTCCCCAGGCGGCGTCCGCGGAGACACCCATCCGTGAACCCCAGGTCCCGGGCCGCCGGCTCGCCGCGCACCAGGGGCCGGCGGACAGAAGAGCGGCCGAGCGGCTCGAGGCTGGGGGACCGCGGGCGCGGCCGCGCGCTGCCGGGCGGGAGGCTGGGGGGCCGGGGCCGGGGCCGTGCCCCGGAGCG...

Embodiment 2

[0066] Example 2 Characterization of Mesenchymal Stem Cells Infected with Viruses

[0067]1. For lentivirus infection of mesenchymal stem cells, take 950 μL 1×HBS into the EP tube, add 10 μg bFGF plasmid, mix well, slowly add 50 μL CaCl2 solution (2M), mix well and let it stand for 20 minutes, then add to the cell state In 293T cells with a good density of about 60%-70%, mix gently, put in 37°C, 5% CO 2 After 12 hours, the medium was replaced with 10 mL of 30% FBS complete medium. After 48 hours, the cell supernatant was collected and centrifuged at 4000 rpm for 15 minutes at room temperature. Take the supernatant and add it to the mesenchymal stem cells that have grown to 50%-60%, add polybrene with a final concentration of 8ug / mL, mix well, and put it in 37°C, 5% CO 2 After 12 hours, replace with 10% FBS complete medium.

[0068] 2. Screening of bFGF mesenchymal stem cells, adding puromycin at a final concentration of 2ug / mL to the infected mesenchymal stem cells, and the ...

Embodiment 3

[0081] Example 3 Characterization of exosomes derived from mesenchymal stem cells integrating bFGF fusion protein gene

[0082] 1. Extract wild-type mesenchymal stem cells, mesenchymal stem cells incubated with bFGF growth factor and exosomes of mesenchymal stem cells integrating bFGF fusion protein gene (bFGF mesenchymal stem cell exosomes). Cultivate the three kinds of cells with 10% FBS complete medium. When the cell density reaches 70%, replace with 0.5% EV Free FBS medium. After 48h, harvest the cell culture supernatant, centrifuge at 500×g for 10min, and take the supernatant , centrifuge at 2000×g for 20min, then take the supernatant, centrifuge at 10000×g for 40min, take the supernatant, ultracentrifuge at 100000×g for 90min, take the precipitate, resuspend with appropriate amount of PBS, ultracentrifuge at 100000×g for 90min, collect the precipitate , resuspended in a small amount of PBS, and stored in an ultra-low temperature refrigerator. All the above centrifugatio...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to a bFGF mesenchymal stem cell exosome and its preparation method and application. The bFGF mesenchymal stem cell exosome is secreted by mesenchymal stem cells and can express bFGF fusion protein on the mesenchymal stem cell membrane of exosomes. In the present invention, for the first time, bFGF is expressed on the membrane of mesenchymal stem cells and mesenchymal stem cell exosomes in the form of fusion protein, which can express a large amount of bFGF protein, and can enhance the specific targeting of mesenchymal stem cell exosomes , Significantly improves the effect of wound repair and reduces the formation of scars. The present invention provides a new safe and efficient drug or medical preparation or medical aesthetic product for promoting tissue repair.

Description

technical field [0001] The present invention relates to the technical field of biomedicine, and more specifically, relates to bFGF mesenchymal stem cell exosomes and a preparation method and application thereof. Background technique [0002] The skin is the largest organ of the human body and is a natural barrier against external pathogens. In cases of acute and chronic skin injuries, burns, high blood pressure, severe diabetes, etc., the integrity of the skin is destroyed, affecting the barrier function of the skin and increasing the risk of infection , and cause pain and decreased tactile perception, so fast and normal wound healing is very important for the body. Adult wounds generally heal through fibrosis and scar formation, and the physiological end point of healing is scar formation. Many wounds that cannot heal remain in a state of chronic inflammation for a long time, which is likely to cause hypertrophic scars or scars, affecting the normal physiology of skin tissu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N5/10C12N15/867C12N15/62A61K35/28A61P17/00A61P17/02A61K8/99A61Q19/00
CPCA61K8/99A61K35/28A61Q19/00A61P17/00A61P17/02C07K14/503C07K14/70585C07K2319/02C07K2319/03C12N5/0662C12N15/86C12N2510/00C12N2740/15043C12N2800/107
Inventor 陈玉容周晗邹衡芳姚基祥廖勇
Owner 广州远想生物科技股份有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com