Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Asparagus U6 gene promoter AspU6p3 and cloning and application thereof

A 35s-aspu6p3-hyg, 35s-aspu6p3-kana technology, applied in the field of genetic engineering, can solve the problems of limited application, lack, lack of research on U6 promoter, etc.

Active Publication Date: 2021-05-28
NANCHANG UNIV +1
View PDF4 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, there is still a lack of research on U6 promoters in asparagus, and the lack of suitable endogenous U6 promoters has become a limiting factor for the construction of asparagus CRISPR / Cas9 genome editing systems, and also limits the application of CRISPR / Cas9 genome editing technology in asparagus breeding

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Asparagus U6 gene promoter AspU6p3 and cloning and application thereof
  • Asparagus U6 gene promoter AspU6p3 and cloning and application thereof
  • Asparagus U6 gene promoter AspU6p3 and cloning and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] Acquisition of U6 Gene Promoter AspU6P3 in Asparagus

[0047] (1) According to the conservation of the U6 gene sequence among different species, use the DNA sequence of the conserved 102bp U6 snRNA of the Arabidopsis thaliana sequence AtU6-26 gene (Genebank accession number: X52528.1) as a reference to search the asparagus genome database (https : / / www.ncbi.nlm.nih.gov / genome / ?term=asparagus), it was found that the asparagus genome contains multiple copies of the U6 gene, and E_Valu>4e was selected -40 The 6 predicted asparagus U6 coding genes were analyzed for transcriptional essential elements of their upstream 1000bp sequences using the Plant CARE online analysis software. The analysis results found that the cis-elements TATA-box and CAAT-box related to basic transcription and enhanced transcription were mainly concentrated within 600 bp upstream of the transcription initiation site of these U6 genes, and were screened from these asparagus U6 promoters. Two promoter...

Embodiment 2

[0056] Construction of asparagus gene editing vector

[0057] (1) AspU6P3 was constructed on gene knockout vectors 35S-ATU6-Hyg and 35S-ATU6-Kana

[0058] The 35S-ATU6-Hyg and 35S-ATU6-Kana vectors were digested with Hind III-HF and XbaI, the Arabidopsis U6 promoter on the vectors was removed, and the 14554bp and 14323bp vector backbone fragments were recovered respectively.

[0059] Primers with homology arms designed for homologous recombination cloning:

[0060] AspU6P3-F: gacggccagtgccaagctt CAGAGCTGTCAAAAACGACTTCG;

[0061] AspU6P3-R: aaaacagagaccgtctagatggtctc GACGTGAGATAGCAAAAGCAAG (the underlined sequence is homologous to the 35S-ATU6-Hyg and 35S-ATU6-Kana vectors).

[0062] Utilize the primer AspU6P3-F / R containing the homology arm, use the AspU6P3 fragment as the template, PCR amplify the AspU6P3 promoter DNA fragment containing the homology arm at both ends, use The recombinase homologously recombined the above fragments into the linearized 35S-ATU6-Hyg and ...

Embodiment 3

[0070] Obtaining gene-edited plants of asparagus and detection of target sequence mutation sites

[0071] (1) In this example, the embryogenic callus of 'JKT4' was transformed with Agrobacterium EHA105-mediated editing vectors 35S-AspU6P3-Hyg-aspIPA1-T2 and 35S-AspU6P3-Kana-aspIPA1-T2. The 35S-AspU6P3-Hyg-aspIPA1-T2 and 35S-AspU6P3-Kana-aspIPA1-T2 vectors were respectively transformed into Agrobacterium EHA105 by freeze-thawing method, and the concentration of the bacteria solution was adjusted to OD600=0.5, and the induction of 2,4-D+KT The embryogenic callus of 'JKT4' was infected, co-cultured for 3 days and cultured in a selection medium containing 50.0 mg / L hygromycin for one month to obtain positive callus, and seedlings were grown on MS medium to obtain plants .

[0072] (2) Detection of target sequence mutation sites in asparagus aspIPA1 plants

[0073] Extraction of Asparagus Gene Knockout T by CTAB Method 0 Genomic DNA of the first generation transgenic plants, fir...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of gene engineering, particularly relates to an asparagus RNA polymerase III type promoter, more particularly relates to an asparagus U6 gene promoter AspU6P3, and further discloses a cloning method and application of the asparagus U6 gene promoter AspU6P3. The asparagus RNA polymerase III-type promoter, namely the asparagus endogenous U6 promoter AspU6P3, is cloned from asparagus (aka the king of vegetables) cultivated species for the first time; the promoter is the asparagus endogenous RNA polymerase III-type promoter and has efficient transcriptional activity, and can drive expression of downstream sgRNA; in addition, The activity of the endogenous U6 promoter AspU6P3 and the feasibility of the endogenous U6 promoter AspU6P3 applied to an asparagus CRISPR / Cas9 gene editing system are verified through an asparagus stable genetic transformation system, and CRISPR / Cas9 mediated asparagus genome targeted editing is realized for the first time.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, specifically relates to an asparagus RNA polymerase type III promoter, more specifically relates to an asparagus U6 gene promoter AspU6P3, and further discloses its cloning method and application. Background technique [0002] Asparagus (Asparagus officinalis L.), also known as Asparagus officinalis L., is a perennial monocotyledonous herbaceous plant belonging to Asparagus family Asparagus. Its fresh bamboo shoots are tender and delicious, rich in nutrition and unique in flavor. It is a nutritious and healthy high-grade vegetable that is deeply loved by consumers. It is traded globally and has high economic value. It is known as the "King of Vegetables". At present, the creation of asparagus germplasm and the selection of new varieties in my country are still dominated by traditional hybrid breeding. Because asparagus is dioecious, the genotype is highly heterozygous, the genome is ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/10C12N15/84C12N15/64C12N15/29A01H5/00A01H6/12
CPCC12N9/1247C12N15/10C12N15/8216C12N15/8218C12N15/8205C07K14/415C12Y207/07006C12Q2531/113
Inventor 朱友林周劲松刘晓京贺热情张冰冰王东叶艳英罗绍春
Owner NANCHANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com