Construction method and application of azoospermia mouse model
A method for constructing a mouse model, which is applied in the field of constructing a mouse model of azoospermia, and can solve the problems of unmentioned testicular phenotype, intellectual disability with microcephaly, delayed speech development, and aggressive behavior.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] Example 1 Expression of Pus7 in various tissues and its expression pattern in testis
[0041] The lung, muscle, kidney, brain, liver, and testis of 90-day wild-type C57BL / 6J mice were extracted, and RNA was extracted respectively, and the expression level of Pus7 gene was detected by qPCR. figure 2 The results of A suggest that PUS7 is highly expressed in the testis. Obtain 2w, 3w, 4w, 5w, 6w, 7w, 8w wild-type mouse testis tissues, extract protein, and perform western blot detection. figure 2 The results of B show that the expression of PUS7 is higher in the testis of mice aged 2 and 3 weeks, and the expression of PUS7 is lower at the age of 4-8 weeks. Immunohistochemical staining of PUS7 was performed on paraffin sections of testes of 90-day-old wild-type mice. figure 2 The results in C showed that PUS7 was expressed in spermatogonia, pachytene spermatocytes, leptotene spermatocytes and Sertoli cells.
Embodiment 2
[0042] Example 2 Constructing a Pus7 Knockout Mouse Model (C57BL / 6)
[0043] In order to further clarify the role of PUS7 in testicular development, Guangzhou Saiye Biological Co., Ltd. was commissioned to construct a Pus7 knockout mouse model using CRISPR / Cas gene editing engineering.
[0044] Design gRNA, targeting exons 1 and 2 of Pus7 (such as image 3 ); the gRNA constructed in vitro (see Table 1 for the sequence of the gRNA) was injected into fertilized eggs to knock out the Pus7 gene.
[0045] Table 1 gRNA targeting sequence
[0046] Primer name Primer sequence (5'-3') Numbering gRNA1 TGGGTTCATTGTAATCGTAACAGG SEQ ID NO.1 gRNA2 CATGCGGGGCTTTTGATCACAGG SEQ ID NO.2
Embodiment 3
[0047] Embodiment 3 mouse genotype identification
[0048] Design primers to identify the mouse genotype obtained in Example 2, the primer design site is as follows image 3 , the primer sequences are shown in Table 2. Genotype identification of 10-day-old neonatal mice: A small amount of mouse tail tissue was obtained, and DNA was extracted using Mouse Direct PCR Kit (Bimake, B40015). PCR was performed using the HotStart enzyme PCR reaction system, and the HotStart enzyme PCR reaction system is shown in Table 3. Prepare 3% agarose gel for DNA electrophoresis, Figure 4 Electropherograms identified for mouse genotyping. from Figure 4 It can be seen that only the 930bp band is a wild-type mouse, only the 690bp band is a homozygous mouse, and the band containing both 690bp and 930bp is a heterozygous mouse.
[0049] Table 2 Primer sequences for genotype identification
[0050] Primer name Primer sequence (5'-3') Numbering Primer-F ATGGATCGGAGGTAAGGGCA...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com