Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Applications of onion[gamma]-glutamylcysteine ligase AcGCL gene in improving heavy metal tolerance of plants

A technology of glutamyl cysteine, transgenic plants, applied in the field of genetic engineering

Pending Publication Date: 2021-04-09
SOUTH CHINA AGRI UNIV
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no report on the research on γ-glutamylcysteine ​​ligase to improve the resistance of onion to heavy metals.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Applications of onion[gamma]-glutamylcysteine ligase AcGCL gene in improving heavy metal tolerance of plants
  • Applications of onion[gamma]-glutamylcysteine ligase AcGCL gene in improving heavy metal tolerance of plants
  • Applications of onion[gamma]-glutamylcysteine ligase AcGCL gene in improving heavy metal tolerance of plants

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1 Acquisition of onion gamma-glutamylcysteine ​​ligase AcGCL gene

[0034] 1. Use the HiPure plant RNA kit (Magen) to extract the total RNA of onion, and the purified RNA can be stored at -20°C.

[0035] 2. Use AMV reverse transcriptase (Roboklon) to reverse transcribe it into cDNA.

[0036] 3. Cloning the full-length cDNA of AcGCL by PCR using 2xTaq Plus Master Mix II DNA polymerase kit (35 cycles: 95°C / 30sec-55°C / 30sec-72°C / 1min / 1kb; final extension: 10 minutes) ( Vazyme, China).

[0037] The PCR primers are as shown in the cloning primers in Table 1;

[0038] Result: the present invention utilizes the sequence alignment of other species GCL known in NCBI ( figure 1 and figure 2), combined with onion EST data, finally cloned the onion γ-glutamylcysteine ​​ligase gene AcGCL, and its expression product has GCL activity. Obtain the onion gamma-glutamylcysteine ​​ligase AcGCL gene, the nucleotide sequence is shown in SEQ ID NO: 1; the protein encoded by the ...

Embodiment 2

[0039] Example 2 Production and determination of onion γ-glutamyl cysteine ​​ligase AcGCL recombinant protease

[0040] To generate the E. coli expression plasmid, the AcGCL coding region without the predicted transient peptide was amplified by PCR. The amplified PCR fragment and pET32a vector were digested with KpnI and HindIII (NEB, UK) and ligated with T4 DNA ligase (NEB, UK). The AcGCL fusion protein with His tag was transformed into Escherichia coli competent C41 (DE3) cells by electroporation, and the protein was expressed in large quantities. After purification and cleavage by TEV protease, the approximately 48 kDa AcGCL protein was separated by SDS-PAGE. Further size exclusion chromatography was used to obtain higher purity AcGCL protein.

[0041] Pure samples of recombinant protein were analyzed for GCL activity in a coupled enzyme assay. Standard reaction mixture (0.5ml) contains 100mM TRIS (pH 8.0), 150mM KCl, 20mM MgCl 2 , 10mM L-cysteine, 20mM L-glutamic acid,...

Embodiment 3

[0045] Example 3 Functional analysis of onion γ-glutamylcysteine ​​ligase AcGCL in young onion roots

[0046] To overexpress AcGCL in young onion roots, we amplified the AcGCL ORF and then cloned it into the pTF101s vector using the primers Forward: CCGGGGATCCTCTAGAATGGCCTCAATTTCCCAATTAC; Reverse: GCAGGTCGACTCTAGATTAGTACAACAACTCCTGG. The constructed vector was transformed into Agrobacterium rhizogenes strain K599, which was then used to transform shallot roots. Transgenic lines were identified by qRT-PCR. For Cd stress experiments, transfer young onion roots to 2 agar medium and further cultured for 2 weeks. Samples were collected and ground in liquid nitrogen before analysis for total thiols and quantitative real-time PCR.

[0047] Mercaptan measurement

[0048] GSH was extracted from onion tissue and derivatized with bromodiphenylamine (Sigma, US). Identification and quantification of GSH was performed according to the method of Liedschulte et al. (2010). By HPLC (Agil...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses applications of onion[gamma]-glutamylcysteine ligase AcGCL gene in improving heavy metal tolerance of plants. The sequence of the onion[gamma]-glutamylcysteine ligase AcGCL gene is shown as SEQ ID NO: 1, and the coding amino acid sequence is shown as SEQ ID NO: 2. Studies show that the AcGCL gene can improve the tolerance of Cd by enhancing the synthesis of glutathione (GSH) and phytochelatin (PC) in onions; and the heavy metal tolerance of plants can be improved by enhancing the expression level of the AcGCL gene in the plants, or the AcGCL gene is utilized to breed new heavy metal-tolerant transgenic plant varieties over-expressing the AcGCL gene.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to the application of onion gamma-glutamyl cysteine ​​ligase AcGCL gene in improving plant resistance to heavy metals. Background technique [0002] Onion (Allium cepa L.) is a plant widely grown in the world. Onions contain a variety of bioactive substances that are beneficial to the human body (including flavonoids and fructo-oligosaccharides, etc.) to help reduce the risk of chronic diseases such as cancer and diabetes. [0003] Cadmium (Cd) is a common toxic heavy metal in the environment, which has a huge impact on the growth and development of plants, and causes irreversible harm to human health through the food chain. Excessive Cd uptake can cause a series of inhibitory symptoms during plant growth and development, and eventually lead to plant death. The growth and development of onions are also severely damaged by Cd. [0004] Glutathione (GSH), a tripeptide, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/52C12N9/00C12N15/82A01H5/00A01H6/56
CPCC12N9/93C12N15/8271C12Y603/02002
Inventor 赵竑博罗薇李瑞郑丰华黄小佳
Owner SOUTH CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com