Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Lotus phytochelatin synthase NnPCS1 and plant expression vector and construction method thereof

A plant expression vector and enzyme gene technology, applied in the field of lotus plant complexin synthase gene NnPCS1 and its plant expression vector and construction, to achieve the effect of improving heavy metal resistance and plant variety improvement

Inactive Publication Date: 2012-10-17
NANJING AGRICULTURAL UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The purpose of the present invention is to provide a new phytochelatin synthase gene NnPCS1 to solve the problem of improving the heavy metal resistance of large ornamental aquatic flowers lotus and repairing water pollution.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Lotus phytochelatin synthase NnPCS1 and plant expression vector and construction method thereof
  • Lotus phytochelatin synthase NnPCS1 and plant expression vector and construction method thereof
  • Lotus phytochelatin synthase NnPCS1 and plant expression vector and construction method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] The cloning of embodiment 1NnPCS1

[0033] The lotus variety ‘Donghe’ (Nelumbo nucifera Gaertn. ‘Donghe’) was selected as the material, and 400μMCdCl 2 Treat the 'Donghe' grown to 6 to 8 leaf stages, and take the young leaves after 3 hours, and extract the total RNA of the leaves according to the instructions of the Trizol RNA extraction kit (TaKaRa), and follow the M-MLV reverse transcription kit ( TaKaRa) 1 μg of total RNA was reverse-transcribed into cDNA.

[0034] Using the extracted leaf cDNA as a template, design primers NnPCS1-F and NnPCS1-R for PCR reaction:

[0035] Upstream primer NnPCS1-F: ATGGCGATGGCAGGTCTATACAGGC (SEQ ID NO.4)

[0036] Downstream primer NnPCS1-R: AGAGACTGAAGGTGTGCTGAGGCCA (SEQ ID NO.5)

[0037] 50 μL reaction system: 5.0 μL of 10×RCR Buffer, 1.0 μL each of NnPCS1-F and NnPCS1-R primers (20 μmol L -1 ), dNTP mix 4.0μL (2.5mmol·L -1 ), Taq DNA Polymerase 0.2μL, cDNA template 1μL, ddH 2 O 37.8 μL; reaction program: pre-denaturation at 95...

Embodiment 2

[0038] Example 2. Construction of plant expression vector pCAMBIA1301-220-NnPCS1

[0039]Design primers NnPCS1-ZF and NnPCS1-ZR for PCR reaction, introduce restriction sites BamHI and Sac I in the upstream and downstream of the target gene NnPCS1 respectively, connect the PCR product to the pMD19-T Simple vector, transform TOP10 competent cells, and extract positive Plasmid, BamHI and Sac I double-digested NnPCS1 fragment was ligated with BamHI and Sac I double-digested pCAMBIA1301-220, transformed, extracted positive, electrophoresis detected and sequenced to verify that it was SEQ ID NO.1. The specific steps were as follows:

[0040] Upstream primer NnPCS 1-ZF: CGCGGATCCATGGCGATGGCAGGTCTATACAGGC (SEQ ID NO.2)

[0041] Downstream primer NnPCS 1-ZR: CGAGCTCAGAGACTGAAGGTGTGCTGAGGCCA (SEQ ID NO.3)

[0042] ①Using the lotus leaf cDNA as a template, high-fidelity enzyme (PrimeSTAR TM HS DNA Polymerase, TaKaRa) for PCR reaction, 50 μL reaction system: 10×HS RCR Buffer 5.0 μL, Nn...

Embodiment 3

[0044] Example 3 Genetic transformation of Arabidopsis thaliana with plant expression vector pCAMBIA1301-220-NnPCS1 and identification of its resistance to heavy metals

[0045] ① Competent preparation and freeze-thaw transformation of Agrobacterium strain EHA105

[0046] Pick a single colony of EHA105 from the YEB (50ug / mL rifampicin) plate, inoculate it in 50mL YEB liquid medium containing 50ug / mL rifampicin, culture at 200rpm, 28°C until the OD value is 0.5, and then ice-bath the bacteria solution 30min, centrifuge to collect the bacteria, suspend in 2mL pre-cooled 100mM CaCl 2 (20% glycerol) solution, 200uL / tube aliquoted for use.

[0047] Take 10uL pCAMBIA1301-220-NnPCS1 vector plasmid, add 200uL EHA105 competent cells, ice bath for 30min, freeze in liquid nitrogen for 5min, 37°C for 5min, add 800uLYEB liquid medium, pre-culture at 28°C 200rpm for 4h, and smear the bacterial solution on YEB ( 50ug / mL rifampicin + 50ug / mL kanamycin) solid medium, cultured in the dark at ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of molecular biology and discloses a lotus phytochelatin synthase gene NnPCS1 and a plant expression vector and a construction method thereof. The sequence of the lotus phytochelatin synthase gene NnPCS1 is represented by SEQ ID No.1. The NnPCS1 is a new heavy metal resistance associated gene and can improve the heavy metal resistance in plants. The plant expression vector of the lotus phytochelatin synthase gene NnPCS1 consists of the lotus phytochelatin synthase gene NnPCS1 and the plant expression vector. The plant expression vector of the NnPCS1 is reported for the first time, can be directly used in Agrobacterium tumefaciens-mediated genetic transformation to develop a new heavy metal resistant variety and improve the heavy metal resistance in the plants and can be used for plant variety improvement.

Description

technical field [0001] The invention belongs to the field of molecular biology, and relates to lotus plant complexin synthase gene NnPCS1 and its plant expression vector and construction method. Background technique [0002] Heavy metal pollution is the main aspect of environmental pollution. According to statistics, the area of ​​cultivated land polluted by heavy metals such as Cd, As, Cr and Pb in my country is nearly 20 million hm2, accounting for about 1 / 5 of the total cultivated land area; among them, 10 million hm2 of cultivated land is polluted by industrial "three wastes", and the area of ​​farmland irrigated by sewage has reached 10 million hm2. Up to more than 3.3 million hm 2[1] . Therefore, the distribution, migration, and transformation of heavy metals in the environment have always been one of the research hotspots in the field of environmental science. [2] . In recent years, the use of phytoremediation of soil and water polluted by heavy metals has been pro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/54C12N15/84A01H5/00
Inventor 刘兆磊顾春笋陈发棣陈素梅陈思思
Owner NANJING AGRICULTURAL UNIVERSITY
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More