Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for culturing anti-stress transgenic plants by using gene CYP710A11

A CYP710A11, transgenic plant technology, applied in the field of genetic engineering, can solve the problems of slow effect, long period of stress-resistant varieties, etc.

Inactive Publication Date: 2013-01-02
CHENGDU INST OF BIOLOGY CHINESE ACAD OF S
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The traditional breeding method has a long cycle and slow effect to breed new stress-resistant varieties, while the transgenic method has quick effects without affecting other existing good traits. It has gradually become the main method for improving stress-resistant varieties

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for culturing anti-stress transgenic plants by using gene CYP710A11
  • Method for culturing anti-stress transgenic plants by using gene CYP710A11
  • Method for culturing anti-stress transgenic plants by using gene CYP710A11

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1 Isolation and Cloning of CYP710A11 Gene

[0034] Tomato (Solanum lycopersicum) Mill.cv.Ailsa Craig was sown in pots and cultivated in a greenhouse. The seedlings grown for 2-3 weeks were used as test materials. Total RNA was extracted from tomato seedlings with Trizol kit (Invitrogen), and cDNA was synthesized with reverse transcription kit (TaKaRa).

[0035] According to the sequence shown by the accession numbers AB223043 and EU224275 of the CYP710A11 gene in the GenBank database, the open reading frame and restriction site of the sequence were analyzed, and primers were designed and synthesized using Primer 5.0 software. Add corresponding enzyme cutting sites at both ends of the start codon and stop codon for vector construction. AB223043 was cloned from tomato by Morikawa T et al [Morikawa T. et al, 2006], EU224275 was obtained from tomato cultivar Rutgers by Whitaker BD and Gapper NE [WhitakerBD and GapperNE, 2008].

[0036] Amplification primers are as...

Embodiment 2

[0041] Example 2ABA-induced CYP710A11 gene expression analysis

[0042] Tomato (Solanum lycopersicum) Xiaokang No. 2 seeds (purchased from Chengdu Kenong Industrial Co., Ltd.) were sown in pots and cultivated in a greenhouse. The seedlings grown for 2-3 weeks were used as test materials. The test was divided into 2 groups. One group sprayed leaves with 2mg / L ABA; one group sprayed leaves with water as a control treatment. There were 3 replicates in each treatment group, with 10 seedlings in each replicate. After 24 hrs, the leaves were taken, RNA was extracted (Trizol kit, Invitrogen) and reverse-transcribed (Reverse Transcription Kit, TAKARA) to synthesize a cDNA template.

[0043] The conserved Actin gene in plants was selected as an internal reference gene, and the amplified fragment was about 180bp, and the primers used were:

[0044] ACT-F: 5'GGGATGATATGGAGAAGATA 3'

[0045] ACT-R: 5'AGTACAGCCTGAATAGCAAC 3'

[0046] Fluorescent quantitative primers were designed acco...

Embodiment 3

[0050] Example 3 Construction of tomato CYP710A11 gene plant overexpression vector

[0051] The vector pMD18-T-CYP710A11 obtained in Example 1 containing the CYP710A11 gene was constructed into the plant expression vector p2355 [Ma Xinrong, 2008] after corresponding double digestion with BamH I and Kpn I and ligation with T4 ligase (NEB) , named p23-CYP710A11. Plasmid p2355 was constructed by our laboratory on the basis of pCAMBIA2301 (licensed by CAMBIA), with a length of 12577bp, a kanamycin resistance gene and a GUS marker gene; it contains a promoter, a terminator unit, and a multiple cloning site in between region, where foreign fragments are inserted. The constructed vector p23-CYP710A11 was introduced into Agrobacterium tumefaciens EHA105 by freeze-thaw method and stored in liquid nitrogen.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of gene engineering and particularly relates to a method for culturing anti-stress plants by using cytochrome P450 gene CYP710A11 in solanum lycopersicum and by technical means such as gene engineering. The method can improve the anti-stress capacities of plants such as salt tolerance, drought tolerance and the like. The gene CYP710A11 in solanum lycopersicum can be connected to different plant expression vectors, so that anti-stress plants can be obtained through the transformation by different expression vectors. The invention can obviously improve the tolerance of the transgenic plants to salt, drought, heavy metals and the like.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and specifically relates to using tomato cytochrome P450 gene CYP710A11 to cultivate stress-resistant plants through technical means such as genetic engineering, and to improve the ability of plants to resist stress such as salt tolerance and drought resistance. Background technique [0002] The discovery and utilization of new functions of known genes, as well as the function research of unknown genes, provide an important basis for expanding the gene resource pool and effectively utilizing gene resources, which is one of the important directions of gene function research. Drought and soil salinity are the most important environmental factors threatening global agricultural production. In addition, climate change and environmental damage have exacerbated extreme weather such as drought, low temperature and freezing in recent years, causing the area affected by drought and salt damage...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/53
Inventor 马欣荣毛萍栗丹
Owner CHENGDU INST OF BIOLOGY CHINESE ACAD OF S
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com