Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Dendrobium officinale salt induced promoter proDoMYB75 and application thereof

A promoter and salt-induced technology, applied in the field of genetic engineering, can solve problems such as abnormal growth and development of plants, yield reduction, etc., and achieve the effect of improving growth characteristics and improving growth characteristics.

Active Publication Date: 2021-09-21
SOUTH CHINA BOTANICAL GARDEN CHINESE ACADEMY OF SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The first object of the present invention is to provide a salt-inducible promoter proDoMYB75 of Dendrobium officinale, which solves the problems of abnormal plant growth and development and production reduction caused by high-salt environment in the prior art

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Dendrobium officinale salt induced promoter proDoMYB75 and application thereof
  • Dendrobium officinale salt induced promoter proDoMYB75 and application thereof
  • Dendrobium officinale salt induced promoter proDoMYB75 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] 1 material

[0021] 1.1 Plant material

[0022] Dendrobium officinale Kimura et Migo (Dendrobium officinale Kimura et Migo) tissue culture seedlings were grown on the medium of 1 / 2MS+mass fraction 0.1% activated carbon+mass fraction 2% sucrose+mass fraction 0.6% agar powder (pH 5.4), and the conditions in the tissue culture room were 24±2°C, 12 hours light.

[0023] 2. Method

[0024] 2.1 Extraction of Genomic DNA from Dendrobium officinale

[0025] Grind Dendrobium officinale seedlings into powder in liquid nitrogen, transfer to a 2mL centrifuge tube, add 700 μL of preheated (65°C) 2×CTAB extract, mix well, place the mixture in a water bath at 65°C for 15 minutes, and shake every 5 minutes once. Take out the mixture and cool it at room temperature, then add an equal volume of phenol chloroform, shake and mix, and centrifuge at 12000r / min for 15min. Take the supernatant, add 700 μL chloroform and extract again, transfer the supernatant to a new 1.5mL centrifuge tub...

Embodiment 2

[0043] 2 methods

[0044] 2.1 Vector construction and genetic transformation of GUS expression driven by promoter proDoMYB75

[0045] Design and reference the amplified promoter proDoMYB75 and construct an overexpression vector. The high-fidelity enzyme used is Toyo Mito High-fidelity DNA Polymerase Kit (KOD FX). For details, please refer to the instruction manual. The primer used was proDoMYB75-1391ZF: ACGGATCCCCGGGAATTC CGATGTGGAACCAACATCCG, proDoMYB75-1391ZR ACGA CGGCCAGTGAATTC TGAGAGGTTAGCAGAGGACC, the underline indicates the linker used to construct the vector, and the proDoMYB75 fragment of the promoter was amplified using the Dendrobium officinale genomic DNA as a template. The vector was constructed using TaKaRa's In-Fusion kit. The homologous recombination reaction system is as follows:

[0046]

[0047]

[0048] After reacting at 50°C for 60 minutes, place it on ice immediately for subsequent transformation experiments, or store it at -20°C for later us...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a dendrobium officinale salt induced promoter proDoMYB75 and an application thereof. The nucleotide sequence of the promoter is as shown in SEQ ID NO: 1, or a nucleotide sequence complementary to the nucleotide sequence as shown in SEQ ID NO: 1, or a DNA molecule which has more than 75% of homology with the nucleotide sequence as shown in SEQ ID NO: 1 and also has a starting function. The dendrobium officinale salt induced promoter proDoMYB75 can specifically drive an exogenous gene to express in different tissues of arabidopsis thaliana under a high-salt induction condition, such as leaves and stems, so that the dendrobium officinale salt induced promoter proDoMYB75 has an important practical value for improving the growth characteristics of plants, especially improving the high-salt resistance of the plants, and has important guiding significance for effectively improving the high-salinity resistance of the plants.

Description

Technical field: [0001] The invention relates to the technical field of genetic engineering, in particular to a salt-inducible promoter proDoMYB75 of Dendrobium officinale and its application. Background technique: [0002] In the natural environment, plants may face unfavorable environmental conditions, such as drought, salt stress, extreme weather and other unfavorable environmental factors, resulting in lag in plant growth and development, reduced yield, and even plant death. Among them, soil salinization is considered to be a key factor restricting global crop yield and quality. Salt stress leads to complex plant physiology and metabolism such as osmotic stress, ion imbalance, ion poisoning and active oxygen damage (Parida et al.2005). [0003] In response to salt stress, plants have evolved various response mechanisms to reduce the damage to themselves caused by salt stress. Plants, for example, alter multiple metabolic pathways, including the production of compatible ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/82A01H5/00A01H6/20A01H6/62
CPCC07K14/415C12N15/8237
Inventor 何春梅段俊张明泽
Owner SOUTH CHINA BOTANICAL GARDEN CHINESE ACADEMY OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com