Dendrobium officinale salt induced promoter proDoMYB75 and application thereof
A promoter and salt-induced technology, applied in the field of genetic engineering, can solve problems such as abnormal growth and development of plants, yield reduction, etc., and achieve the effect of improving growth characteristics and improving growth characteristics.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0020] 1 material
[0021] 1.1 Plant material
[0022] Dendrobium officinale Kimura et Migo (Dendrobium officinale Kimura et Migo) tissue culture seedlings were grown on the medium of 1 / 2MS+mass fraction 0.1% activated carbon+mass fraction 2% sucrose+mass fraction 0.6% agar powder (pH 5.4), and the conditions in the tissue culture room were 24±2°C, 12 hours light.
[0023] 2. Method
[0024] 2.1 Extraction of Genomic DNA from Dendrobium officinale
[0025] Grind Dendrobium officinale seedlings into powder in liquid nitrogen, transfer to a 2mL centrifuge tube, add 700 μL of preheated (65°C) 2×CTAB extract, mix well, place the mixture in a water bath at 65°C for 15 minutes, and shake every 5 minutes once. Take out the mixture and cool it at room temperature, then add an equal volume of phenol chloroform, shake and mix, and centrifuge at 12000r / min for 15min. Take the supernatant, add 700 μL chloroform and extract again, transfer the supernatant to a new 1.5mL centrifuge tub...
Embodiment 2
[0043] 2 methods
[0044] 2.1 Vector construction and genetic transformation of GUS expression driven by promoter proDoMYB75
[0045] Design and reference the amplified promoter proDoMYB75 and construct an overexpression vector. The high-fidelity enzyme used is Toyo Mito High-fidelity DNA Polymerase Kit (KOD FX). For details, please refer to the instruction manual. The primer used was proDoMYB75-1391ZF: ACGGATCCCCGGGAATTC CGATGTGGAACCAACATCCG, proDoMYB75-1391ZR ACGA CGGCCAGTGAATTC TGAGAGGTTAGCAGAGGACC, the underline indicates the linker used to construct the vector, and the proDoMYB75 fragment of the promoter was amplified using the Dendrobium officinale genomic DNA as a template. The vector was constructed using TaKaRa's In-Fusion kit. The homologous recombination reaction system is as follows:
[0046]
[0047]
[0048] After reacting at 50°C for 60 minutes, place it on ice immediately for subsequent transformation experiments, or store it at -20°C for later us...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com