Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Triple vaccine for salmonella, riemerella anatipestifer and escherichia coli

A technology of Escherichia coli and Duck Riemer's, which is applied in the field of veterinary biological products, can solve problems such as uneven feed nutrition, poor breeding environment in farms, and large temperature and humidity differences, achieving high toxicity, Good anti-virus protection, good safety effect

Active Publication Date: 2021-04-09
青岛博霖生物科技有限公司
View PDF17 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, uneven feed nutrition, poor breeding environment in the farm, large temperature and humidity differences in the house, sudden change of feed, and other stress factors can all induce the disease.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Triple vaccine for salmonella, riemerella anatipestifer and escherichia coli

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1: Information on the S01 strain of Salmonella typhimurium

[0024] 1. Epidemiological investigation Since 2017, the inventor has investigated the epidemiology of Salmonella, and carried out follow-up investigations to some duck farms. The survey found that Salmonella is widely present in duck farms in my country.

[0025] 2. Bacterial isolation Collect lungs, hearts, livers, intestines and fecal swabs of suspected dead ducks. Sample collection and isolation methods are mainly in accordance with national standards (GB 4789.4-2016). Disinfect the surface of the diseased material with 75% alcohol, collect the viscera aseptically and cut them into pieces, put them in a sterile homogeneous bag with BPW, and culture them with shaking at 37°C and 150r / min for 8 hours for pre-enrichment, then take 1mL for enrichment. Bacterial solution was statically cultured in 10mL TTB at 42°C for 20-24h for selective enrichment, and then dipped with an inoculation loop to draw 10 μ...

Embodiment 2

[0034] Example 2: Information on Riemerella anatipestifer R01 strain

[0035] 1. Epidemiological investigation Since 2017, the inventor has investigated the epidemiology of Riemerella anatipestifer, and carried out follow-up investigations to some duck farms. The survey found that the disease is now widespread in duck farms in my country.

[0036] 2. Isolation and identification Take suspected disease materials and inoculate TSA medium (containing 0.01% NAD and 5% calf serum), culture at 37°C for 24-48 hours, pick suspected colonies and use 16S rRNA PCR for identification (F: ACTTCAGGTACCCCCAGCTT ; R: GTGCCGTGAGGTGTTAGGTT; 364bp), a total of 43 strains of Riemerella anatipestifer were isolated.

[0037] 3. Morphology and biochemical characteristics Riemerella anatipestifer can form round, slightly protruding, creamy small colonies with smooth surface on TSA (the colonies appear light blue when viewed against the light). Gram-stained microscopic examination shows scattered or...

Embodiment 3

[0043] Example 3: Information on Escherichia coli E01 strain

[0044] 1. Epidemiological investigation Since 2017, the inventor has conducted an epidemiological investigation on Escherichia coli in duck farms, and conducted follow-up investigations on some duck farms. The survey found that the disease is now widespread in duck farms in my country.

[0045] 2. Isolation and identification Add the anal swabs of suspected organs or ducks to LB medium and incubate at 37°C for 16-20 hours, then use an inoculation loop to dip in the bacterial solution and inoculate it on MacConkey agar, and incubate at 37°C for 16-20 hours. hours, then pick colonies and inoculate them on eosin methylene blue plate at 37°C for 16-20 hours;

[0046] 3. Morphology and biochemical characteristics On MacConkey agar, it is bright pink or deep pink, round, with neat edges and smooth surface; meanwhile, on eosin methylene blue agar, it is dark purple-black, smooth, round with metallic luster , identified ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of veterinary biological products, and particularly relates to a triple vaccine for salmonella, riemerella anatipestifer and escherichia coli. Antigens adopted are an inactivated salmonella typhimurium S01 strain, a riemerella anatipestifer R01 strain and an escherichia coli E01 strain. The three strains used by the vaccine disclosed by the invention are high in toxicity and immunogenicity and have relatively good cross protectiveness. The vaccine prepared by the invention is good in safety, and any local and systemic adverse reactions caused by the vaccine are avoided. Various indexes are stable and effective through analysis of characters, and data in the safety test and efficacy test in a storage life test; and results of the efficacy test prove that the triple inactivated vaccine can generate a good antibody and can generate relatively good toxicity protection efficiency.

Description

Technical field: [0001] The invention belongs to the technical field of veterinary biological products, in particular to a triple vaccine against Salmonella, Riemerella anatipestifer and Escherichia coli. Background technique: [0002] Salmonella typhimurium is an important zoonotic pathogen with a wide range of hosts and can cause a variety of acute or chronic infectious diseases in humans and animals. Among them, Salmonella typhimurium of animal origin poses a serious threat to livestock breeding and human health. public health significance. The use of antibacterial drugs is an important measure to treat Salmonella infection, but due to the abuse and indiscriminate use of antibacterial drugs by humans, severe bacterial resistance has been caused. Previous data show that 90% of antibiotics are used in food animals every year in the world. Animals have become an important storage host for drug-resistant bacteria, and drug-resistant bacteria and drug-resistant gene elements ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K39/112A61K39/108A61K39/02A61P31/04C12N1/20C12R1/42C12R1/19C12R1/01
CPCA61K39/0208A61K39/0258A61K39/0275A61P31/04A61K2039/70A61K2039/552A61K2039/521A61K39/025A61K2039/55511A61K2039/55588A61K2039/575
Inventor 郭莉莉赵永达马丽华
Owner 青岛博霖生物科技有限公司
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More