Triple vaccine for salmonella, riemerella anatipestifer and escherichia coli
A technology of Escherichia coli and Duck Riemer's, which is applied in the field of veterinary biological products, can solve problems such as uneven feed nutrition, poor breeding environment in farms, and large temperature and humidity differences, achieving high toxicity, Good anti-virus protection, good safety effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] Example 1: Information on the S01 strain of Salmonella typhimurium
[0024] 1. Epidemiological investigation Since 2017, the inventor has investigated the epidemiology of Salmonella, and carried out follow-up investigations to some duck farms. The survey found that Salmonella is widely present in duck farms in my country.
[0025] 2. Bacterial isolation Collect lungs, hearts, livers, intestines and fecal swabs of suspected dead ducks. Sample collection and isolation methods are mainly in accordance with national standards (GB 4789.4-2016). Disinfect the surface of the diseased material with 75% alcohol, collect the viscera aseptically and cut them into pieces, put them in a sterile homogeneous bag with BPW, and culture them with shaking at 37°C and 150r / min for 8 hours for pre-enrichment, then take 1mL for enrichment. Bacterial solution was statically cultured in 10mL TTB at 42°C for 20-24h for selective enrichment, and then dipped with an inoculation loop to draw 10 μ...
Embodiment 2
[0034] Example 2: Information on Riemerella anatipestifer R01 strain
[0035] 1. Epidemiological investigation Since 2017, the inventor has investigated the epidemiology of Riemerella anatipestifer, and carried out follow-up investigations to some duck farms. The survey found that the disease is now widespread in duck farms in my country.
[0036] 2. Isolation and identification Take suspected disease materials and inoculate TSA medium (containing 0.01% NAD and 5% calf serum), culture at 37°C for 24-48 hours, pick suspected colonies and use 16S rRNA PCR for identification (F: ACTTCAGGTACCCCCAGCTT ; R: GTGCCGTGAGGTGTTAGGTT; 364bp), a total of 43 strains of Riemerella anatipestifer were isolated.
[0037] 3. Morphology and biochemical characteristics Riemerella anatipestifer can form round, slightly protruding, creamy small colonies with smooth surface on TSA (the colonies appear light blue when viewed against the light). Gram-stained microscopic examination shows scattered or...
Embodiment 3
[0043] Example 3: Information on Escherichia coli E01 strain
[0044] 1. Epidemiological investigation Since 2017, the inventor has conducted an epidemiological investigation on Escherichia coli in duck farms, and conducted follow-up investigations on some duck farms. The survey found that the disease is now widespread in duck farms in my country.
[0045] 2. Isolation and identification Add the anal swabs of suspected organs or ducks to LB medium and incubate at 37°C for 16-20 hours, then use an inoculation loop to dip in the bacterial solution and inoculate it on MacConkey agar, and incubate at 37°C for 16-20 hours. hours, then pick colonies and inoculate them on eosin methylene blue plate at 37°C for 16-20 hours;
[0046] 3. Morphology and biochemical characteristics On MacConkey agar, it is bright pink or deep pink, round, with neat edges and smooth surface; meanwhile, on eosin methylene blue agar, it is dark purple-black, smooth, round with metallic luster , identified ...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com