CRISPR/Cas9 system for constructing Leber congenital amaurosis cloned porcine nuclear donor cells and application of CRISPR/Cas9 system

A technology for recombinant cells and expression vectors, applied in applications, nucleic acid vectors, animal cells, etc., can solve the problems of low probability of homozygous mutant offspring and inapplicability, and achieve improved nuclear localization capabilities, reduced workload, and multiplication speed slow effect

Active Publication Date: 2021-03-19
NANJING KGENE GENETIC ENG CO LTD
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

For example, the method of embryo transfer after microinjection of gene-editing materials into fertilized eggs used in the production of mouse models, because the probability of directly obtaining ho

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CRISPR/Cas9 system for constructing Leber congenital amaurosis cloned porcine nuclear donor cells and application of CRISPR/Cas9 system
  • CRISPR/Cas9 system for constructing Leber congenital amaurosis cloned porcine nuclear donor cells and application of CRISPR/Cas9 system
  • CRISPR/Cas9 system for constructing Leber congenital amaurosis cloned porcine nuclear donor cells and application of CRISPR/Cas9 system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0076] Example 1 Construction of Cas9 high-efficiency expression vector and construction of pKG-U6gRNA vector

[0077] 1.1 Construction of pU6gRNA-eEF1a-mNLS-hSpCas9-EGFP-PURO (Cas9 high-efficiency expression vector)

[0078] (1) Remove redundant and invalid sequences in the gRNA backbone

[0079] pX330-U6-Chimeric_BB-CBh-hSpCas9 (referred to as pX330, figure 1 ) was digested with BbsI and XbaI, and the vector fragment (about 8313bp) was recovered, and the insert fragment 175bp (SEQ ID NO: 31) was synthesized by the multi-fragment recombination method, and recombined with the recovered vector fragment to obtain the pU6gRNACas9 vector ( figure 2 ).

[0080] (2) Transformation of promoters and enhancers

[0081] For the constructed pU6gRNACas9 vector, use XbaI and AgeI endonucleases to remove the promoter (chickenβ-actin promoter) and enhancer sequence (CMV enhancer), recover the linear vector sequence of about 7650bp, and use the multi-fragment recombination method to synth...

Embodiment 2

[0096] Example 2 Plasmid Proportion Optimization and Effect Comparison of Plasmid pX330 and Plasmid pKG-GE3

[0097] 2.1 gRNA target design and construction

[0098] 2.1.1 Using Benchling to design gRNA targets for the RAG1 gene

[0099] RAG1-gRNA4: AGTTATGGCAGAACTCAGTG (SEQ ID NO.4)

[0100] The complementary DNA oligo of the inserted sequence of the synthetic RAG1 gene with a total of 2 targets is as follows:

[0101] RAG1-gRNA4S: caccgAGTTATGGCAGAACTCAGTG (SEQ ID NO.5)

[0102] RAG1-gRNA4A: aaacCACTGAGTTCTGCCATAACTc (SEQ ID NO. 6)

[0103] Both RAG1-gRNA4S and RAG1-gRNA4A are single-stranded DNA molecules.

[0104] 2.1.2 Primers designed to amplify the fragment containing the RAG1 gRNA target

[0105] RAG1-nF126: CCCCATCCAAAGTTTTTAAAGGA (SEQ ID NO. 7)

[0106] RAG1-nR525: TGTGGCAGATGTCACAGTTTAGG (SEQ ID NO. 8)

[0107] 2.1.3 The method of cloning the gRNA sequence into the pKG-U6gRNA backbone vector

[0108] 1) Digest 1ug pKG-U6gRNA plasmid with restriction endonucl...

Embodiment 3

[0158] Example 3 Design and construction of RPE65 gene target

[0159] 3.1 Genomic DNA extraction

[0160] 18 pigs (male A, B, C, D, E, F, G, H female 1, 2, 3, 4, 5) were performed using Vazyme's FastPure Cell / Tissue DNA Isolation Mini Kit (VazymeCat.DC102-01). , 6, 7, 8, 9, 10) Genomic DNA from ear tissue was extracted by column, quantified using NanoDrop, and stored at -20°C for future use.

[0161] 3.2 RPE65 gene knockout predetermined target and conservation analysis of adjacent genome sequences

[0162] 3.2.1 Pig RPE65 gene information

[0163] Encodes retinoid isomerohydrolase (Retinoid isomerohydrolase); located on chromosome 6; GeneID is 100516743, Sus scrofa. Existing research results have shown that RPE65 plays a central role in bone mass regulation. In pig genomic DNA, the RPE65 gene has 14 exons, of which the fifth exon occupies an important position in all transcripts (porcine RPE65 gene The 5th exon sequence, including the 4th exon, the 4th intron and part of...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a CRISPR/Cas9 system for constructing Leber congenital amaurosis cloned porcine nuclear donor cells and application of the CRISPR/Cas9 system. The sequence of the gRNA of the pig RPE65 gene is shown as SEQ ID NO. 23. The CRISPR/Cas9 system for editing the pig RPE65 gene comprises the gRNA expression vector disclosed by the invention and a Cas9 expression vector. Wherein theCas9 expression vector is pU6gRNA eEF1a-mNLS-hSpCas9-EGFP-PURO. Gene editing is carried out by adopting the Cas9 efficient expression vector which is combined modified by gRNA screened by the invention, and the editing efficiency is improved by over 100 percent compared with that of an original vector. The invention lays a solid foundation for the preparation of a Leber congenital amaurosis pig model, and has important application value for the treatment and pathological research of the Leber congenital amaurosis pig model.

Description

technical field [0001] The invention belongs to the technical field of gene editing, and relates to a CRISPR / Cas9 system for gene editing of pig RPE65 and its application, in particular to a gRNA target point of the pig RPE65 gene and a CRISPR / Cas9 system, and its use in constructing RPE65 gene knockout or Application of Inserted Amaurosis Cloning Porcine Nuclear Donor Cells. Background technique [0002] Congenital amaurosis (Leber congenital amaurosis, LCA), also known as hereditary congenital retinopathy, -Olsen syndrome, etc., is the earliest and most serious hereditary retinopathy, accounting for more than 5% of hereditary retinopathy, and is the main disease that causes congenital blindness in children (accounting for 10%-20%), per 100,000 Two to three newborns are affected, mostly autosomal recessive disorders. [0003] More than 20 pathogenic genes related to amaurosis have been confirmed through genome scanning, candidate gene technology and linkage analysis, amo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/55C12N15/113C12N15/85C12N15/90C12N15/65C12N5/10
CPCC12N9/18C12N15/1137C12N15/85C12N15/907C12N15/65C12N9/22C12N5/0656C12Y301/01064C12N2310/20C12N2800/107C12N2830/48C12N2830/50C07K2319/09C07K2319/60C12N2510/00Y02A50/30
Inventor 牛冬汪滔陶裴裴曾为俊王磊程锐马翔赵泽英刘璐黄彩云
Owner NANJING KGENE GENETIC ENG CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap