Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Genetically engineered bacterium for producing L-homoserine and application of genetically engineered bacterium

A technology of genetically engineered bacteria and homoserine, applied in the field of high-yield L-homoserine, can solve the problems of large environmental pollution, high technical barriers, complex processes, etc., and achieve the effects of less environmental pollution, wide application prospects and high yield

Active Publication Date: 2021-02-19
TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, homoserine is mainly produced by chemical synthesis, which has problems such as complex process, high technical barriers, low safety, and large environmental pollution, which also limits the application of the product in food, medicine and other industries

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genetically engineered bacterium for producing L-homoserine and application of genetically engineered bacterium
  • Genetically engineered bacterium for producing L-homoserine and application of genetically engineered bacterium
  • Genetically engineered bacterium for producing L-homoserine and application of genetically engineered bacterium

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Embodiment 1 Corynebacterium glutamicum L-homoserine kinase gene thr B Construction of deletion strains

[0025] (1) to C. glutamicum The ATCC13032 genome was used as a template, and the primers thrB1-F / thrB1-R, thrB2-F / thrB2-R were used to perform PCR to obtain fragments thrB1 and thrB2, respectively. Then use the above-mentioned obtained PCR product as a template, and use thrB1-F / thrB2-R as primers to obtain a complete DNA fragment by fusion PCR, and pass the above-mentioned obtained DNA fragment through Bam H I and Xba After I double digestion, it was connected to the vector pCRD206 to obtain the knockout plasmid pCRD-thrB. Wherein, the L-homoserine kinase gene in this embodiment thr B Amino acid and nucleotide sequences (GenBank: CAF19888.1).

[0026] The primer information used is as follows:

[0027] thrB1-F: CGCGGATCCTTGAGGTTATCGGCGGCATTG

[0028] thrB1-R: GACTCACGAGCATCTTCCGACCGACGTTCAGTTCAATTG

[0029] thrB2-F: TGAACTGAACGTCGGTCGGAAGATGCTCGTGAGTCTG...

Embodiment 2

[0039] Example 2 Enhanced expression of aspartokinase hydrolysis feedback inhibition mutant gene lysC* (C932T) and homoserine dehydrogenase hydrolysis feedback inhibition mutant gene hom* (G1133A) at chromosome level.

[0040] (1) In order to realize the C932T point mutation of the lysC gene at the chromosome level, first use C. glutamicum The ATCC13032 genome was used as a template, and the DNA sequences lysC1 and lysC2 were obtained by PCR using primer pairs lysC1-F / lysC1-R and lysC2-F / lysC2-R respectively. Using the method of fusion PCR, the primer pair lysC1-F / lysC2-R was used to obtain the DNA fragment lysC*. The DNA fragment obtained above was passed through Bam H I and spe After I double digestion, it was connected to the vector pCRD206 to obtain the point mutation plasmid pCRD-lysC*. Electrotransfer of Point Mutation Plasmid pCRD-lysC* into L-homoserine Kinase Gene of Corynebacterium glutamicum thr B Deletion strain HSE-1 cells. Electroporation conditions are ...

Embodiment 3

[0069] Example 3 Analysis of homoserine produced by fermentation of different homoserine strains

[0070] Inoculate Corynebacterium glutamicum wild-type ATCC 13032 and Corynebacterium glutamicum engineering strains HSE-1, HSE-2, HSE-3, HSE-4 and HSE-5 obtained above into 20-25mL seed medium containing In a 250 mL Erlenmeyer flask, culture for 12h~16h to mid-logarithmic phase. Then the cells were collected by centrifugation, suspended with fresh fermentation medium, inoculated into a 250 mL Erlenmeyer flask containing 50 mL of fermentation medium, and the initial OD 600 0.8~1.2, and add 5~15 g / L CaCO 3 . The fermentation conditions were 30 ºC, 150-200 rpm, constant temperature shaking culture. The fermentation medium is: glucose 50~60 g / L, urea 0.1~0.2 g / L, corn steep liquor 5~10 g / L, ammonium sulfate 15~20 g / L, KH 2 PO 4 5~6 g / L, MgSO 4 ·7H 2 O 2 ~5 ​​g / L, FeSO 4 ·7H 2 O 0.2~0.5 g / L, MnCl 2 4H 2 O 0.2~0.4 g / L, biotin 0.2~0.4 mg / L, vitamin B1 1~2 mg / L, vitamin B6 1~2...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a genetically engineered bacterium for high production of L-homoserine. The expression of an L-homoserine kinase encoding gene thrB in the bacterium is weakened or eliminated.An aspartate kinase feedback inhibition mutant gene lysC, a homoserine dehydrogenase feedback inhibition mutant gene hom, an overexpression aspartate kinase feedback inhibition mutant gene thrA and atransporter gene are further intensively expressed. The L-homoserine high-producing strain constructed by the invention can produce L-homoserine with a relatively high level, and in the optimal embodiment, after the genetically engineered bacterium disclosed by the invention is fermented for 72 hours, the content of the L-homoserine can reach 63.2 + / -5.4 g / L.

Description

technical field [0001] The invention belongs to the technical field of synthetic biology and metabolic engineering, and specifically relates to a method for high-yielding L-homoserine through a metabolic engineering strategy. Background technique [0002] Homoserine is an important non-protein amino acid, which participates in various physiological and biochemical reactions and biological metabolic processes in the body, and has important physiological functions and application values. Due to the rich biological activity of homoserine and its derivatives, it has a wide range of applications in the fields of food, agriculture and medicine. Homoserine can be used as an antifungal drug to effectively prevent mycobacterial tuberculosis, etc.; as a pharmaceutical intermediate, it can be used to prepare a variety of biologically active drugs; in addition, homoserine can also be used as an important intermediate for the synthesis of acrylic acid, 3-hydroxypropionyl - High value-ad...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21C12N15/77C12P13/06C12R1/15
CPCC12N9/0006C12N9/1205C12N9/1217C12N15/52C12N15/77C12P13/06C12Y101/01003C12Y207/01039C12Y207/02004
Inventor 刘君魏亮徐宁
Owner TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products