Diaphorina citri chitin binding protein Chitinase-like EN03 as well as encoding gene and application thereof
A citrus psyllid and protein-binding technology, applied in the fields of application, genetic engineering, plant genetic improvement, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Example 1 Screening of Chitin-binding Protein of Citrus Psylla figure 1 ),Specific steps are as follows:
[0029] 1. Extraction of total protein from the epidermis of citrus psyllids
[0030] (1) Take citrus psyllid adult epidermis in a 2mL centrifuge tube, and wash twice with PBS (in the process of taking citrus psyllid epidermis, the taken epidermis should be placed on ice immediately);
[0031] (2) Quickly put the sample obtained in step (1) into an ultra-low temperature refrigerator (-80℃) for freezing;
[0032] (3) Take out the sample of step (2) from the low-temperature refrigerator and grind it into powder with liquid nitrogen;
[0033] (4) Add pre-cooled PBS at a ratio of 0.5g / mL;
[0034] (5) Mix thoroughly, then centrifuge at 12000 rpm at 4°C for 10 min, take the supernatant, and obtain PBS-1;
[0035] (6) Repeat steps (4) and (5) twice to obtain PBS-2 and PBS-3 respectively;
[0036] (7) Recover the precipitate in step (6), add 2% SDS extraction buffer at a ratio of 0.5 g...
Embodiment 2
[0058] Example 2 In vitro chitin binding experiment of prokaryotic expression protein
[0059] The prokaryotic expression of Chitinase-like EN03 coding gene was entrusted to Hangzhou Huaan Biological Company. The purified protein obtained was subjected to the chitin in vitro binding experiment. The experimental method refers to step 3 in Example 1, and only the final concentration of NaCl in the binding buffer is increased. To 500mM. See results Figure 5 , Where M: protein marker, FT: effluent, W1-3: washing liquid first, second, and third time, E: eluent. by Figure 5 It can be seen that the Chitinase-like EN03 protein expressed in prokaryotic cells can bind chitin in vitro and has chitin-binding activity. It can also be combined with cellulose as a control.
Embodiment 3
[0060] Example 3dsRNA synthesis and RNA interference analysis
[0061] 1. Synthesis of dsRNA
[0062] According to the Chitinase-like EN03 protein sequence, find the corresponding gene sequence in the NCBI database (> XM_026833073.1PREDICTED: Diaphorina citri chitinase-like proteinEN03 (LOC103523836), mRNA, the nucleotide sequence shown in SEQ ID NO.4: tcgaatcaacgcttggctccgggtttattcaaattgagttctgattgcaagatgcgagctctaagtgttcttttgttcgtcgcttttgcgatatactactgtgaaggcgtggccaaaacggtgtgctactacaaccataaggcattcaagagagatggaacggccaaagttggacccgaggagctgaagccagccctgagcatgtgcacccatttggtgtacgggttcgctgggatttcggacagcggcgactaccacatcaagtccctggacaaggaattggacacggacaagaacaaaggcaaagagctgttcaaacagataaccgcgctgaaaactttccaacccaacctgaacattatgcttagtgtgggaggatttgaagatgatgatgacaaggagaagtatttggaagtgctggatgacccgaaatacagaaagagtttcatcgaaacaactgtggcagctctgaaaaagtacggcttcaacggattggatctggcctgggaattccccgttgtgactgaaaagcacgaatcttacactcttggatccatctggcataaaatcaagaaaaccgtcaccggacccaaggatgacaatccaacccttcatcgtgaacatttcactctgctcatccgag...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com