Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Polymorphic site associated with altitude hypoxia tolerance adaptability and application thereof

A polymorphic site, high altitude hypoxia technology, applied in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc. The effect of broad application prospects and potential

Active Publication Date: 2020-10-02
ZHONGSHAN HOSPITAL FUDAN UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The rs671 site mutation means that the guanine (G) at this site is mutated to adenine (A), making the corresponding glutamic acid (Glu) in the first 17 amino acids of the mitochondrial targeting peptide sequence of aldehyde dehydrogenase 2 Changed to lysine (Lys), resulting in a significant decrease in the activity of the enzyme

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Polymorphic site associated with altitude hypoxia tolerance adaptability and application thereof
  • Polymorphic site associated with altitude hypoxia tolerance adaptability and application thereof
  • Polymorphic site associated with altitude hypoxia tolerance adaptability and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1 Study on Myocardial Hypoxia Tolerance of ALDH2 Knockout Mice

[0034] 1) Construct the intermittent hypoxia model in mice: Oxygen concentration: 5% (40s)-21% (40s); cycle time: 2min; daily intervention time (10h): 8:00-18:00, a total of 4 week intervention.

[0035] 2) Detection of the overall function of the mouse heart: small animal heart B-ultrasound detection of the wall thickness and systolic and diastolic functions of the mouse heart in each group.

[0036] 3) The size and shape of cardiomyocytes: the hearts of each group were taken, weighed, fixed, sliced, stained with HE, and the cross-sectional area of ​​cardiomyocytes under a light microscope; frozen sections of myocardial tissue were prepared, and cell apoptosis was observed by TUNEL staining; Masson staining was used to evaluate the degree of myocardial fibrosis; myocardial DHE fluorescent staining was performed to evaluate the level of ROS in the myocardium; myocardial tissue was stained with Oil...

Embodiment 2

[0050] Example 2 Observation on Adaptability of Cardiomyocyte Hypoxia Tolerance in ALDH2 Point Mutation Knockout Mice

[0051] (1) Research methods:

[0052] The cardiomyocytes of each group of mice were isolated and cultured, and after hypoxia treatment at different time points in vitro, the level of mitophagy in individual cardiomyocytes of mice in each group was detected by immunofluorescence detection, and the key molecules of cardiomyocyte hypoxic metabolism were detected by Western blot ( Such as GLUT-1 and HIF-1α) expression level changes.

[0053] (2) Research results:

[0054] Such as image 3 As shown in A, after hypoxia treatment, the survival rate of cardiomyocytes in the KO group was significantly lower than that in the WT group, and the cell survival rate was less than 50% after 24 hours of hypoxia, which was consistent with the results of animal experiments, suggesting that Cardiomyocyte hypoxia tolerance decreased significantly. Immunofluorescence detection...

Embodiment 3

[0055] Example 3 Human ALDH2rs671 Site Mutation Detection

[0056] (1) Research methods:

[0057] Primer design and dilution,

[0058] Primer information: RS671-F: GGGTCAACTGCTATGATGTGT;

[0059] RS671-R: TTAGTAGGAAACACTGATGGC.

[0060] 1) PCR amplification

[0061] system:

[0062] Element system Premix Taq 10ul Primer1 1ul Primer2 1ul template 1ul wxya 2 o

7ul total 20ul

[0063] Reaction program: 94°C for 5min; 28cycles: 94°C for 30s, 58°C for 30s, 72°C for 1min; 72°C for 10min.

[0064] 2) Purification of PCR products by rubber tapping

[0065] The PCR product was subjected to 2% agarose gel electrophoresis, and the target bands of equal size were cut out, and purified and recovered according to the Tiangen recovery kit (DP214-03).

[0066] 3) Sanger sequencing experiment.

[0067] Sequencing reaction system: total system 5 μl, sequencing primer 2 μl (3.2 μM), purified PCR product 1-3 μl, BigDyeMix kit 1 μl. ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of altitude hypoxia tolerance detection and particularly relates to an SNP site associated with altitude hypoxia tolerance adaptability and an applicationthereof. The invention provides an SNP site rs671 of a gene ALDH2 for predicting the altitude hypoxia tolerance adaptability and an application of the SNP site rs671 to preparation of a kit. The SNP site shows, for the first time, that mutation of the site rs671 of the gene ALDH2 causes low activity of the ALDH2, so that aerobic cells, especially myocardial cells cannot be subjected to effective mitophagy like wild-type cells under the stimulation of a hypoxic condition, a large number of functionally impaired mitochondria are accumulated, a transformation process disorder of energy supply metabolism, namely glycolysis metabolism under the hypoxic condition is further generated, abnormal ATP energy supply of the aerobic cells and oxygen consumption surge under the hypoxic condition are caused, cells of a body and even aerobic organs cannot successfully complete a hypoxic adaptation process, and finally the adaptation of the body to an altitude hypoxia environment is hindered.

Description

technical field [0001] The invention belongs to the technical field of plateau hypoxia tolerance detection, and specifically relates to a polymorphic site related to plateau hypoxia tolerance adaptability and an application thereof. Background technique [0002] my country is the country with the most extensive plateau area, the largest population and the longest plateau border in the world. With the advancement of the western development strategy, many large-scale plateau projects have been put into construction, and the number of people traveling to and from plateau areas due to business and tourism activities is increasing day by day. The impact of plateau extreme hypoxic environment on the health of the body cannot be ignored. At present, it is believed that altitude sickness is a syndrome caused by the incomplete or disordered adaptation ability of the body to the low oxygen environment when moving from low altitude to high altitude. Hypoxic damage to the body caused b...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6888C12Q1/683C12N15/11
CPCC12Q1/6888C12Q1/683C12Q2600/156C12Q2531/113C12Q2521/301
Inventor 葛均波孙爱军董震
Owner ZHONGSHAN HOSPITAL FUDAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com