Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Salmonella efficient traceless gene editing system and application thereof

A Salmonella gene editing technology, applied in the field of genetic engineering, can solve the problem of lack of Salmonella gene editing system and achieve the effect of improving operation efficiency

Pending Publication Date: 2020-07-28
CHANGZHOU HIGH TECH RES INST OF NANJING UNIV +1
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, there is a lack of a fast, efficient and traceless Salmonella gene editing system and its application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Salmonella efficient traceless gene editing system and application thereof
  • Salmonella efficient traceless gene editing system and application thereof
  • Salmonella efficient traceless gene editing system and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] A high-efficiency and scarless gene editing system for Salmonella of the present invention, the high-efficiency and scarless gene editing system for Salmonella includes Cas9 protein, sgRNA, λRed recombinase, DNA fragments of homologous recombination and the vectors used to carry or express these components and gene sequence.

[0048] The high-efficiency traceless gene editing system for Salmonella consists of a double-plasmid CRISPR / Cas9 system, including an auxiliary plasmid A expressing related functional proteins and a targeting plasmid B expressing a target site sgRNA.

[0049] The said helper plasmid A comprises the nucleic acid sequence of the following elements: Cas9 protein, λRed recombinase, thermosensitive replicon, sgRNA expression cassette targeting plasmid B replicon and helper plasmid A selection marker gene, wherein recombinase and sgRNA are induction Express.

[0050] The targeting plasmid B includes the nucleic acid sequence of the following elements: ...

Embodiment 3

[0117] Replacement of the Salmonella VNP20009msbB site with the RFP gene

[0118] The application flow chart of Salmonella high-efficiency traceless gene editing system is as follows: figure 2 shown. On the first day, the pCas plasmid is transferred to Salmonella, and the strain obtained in this step can be preserved for editing a series of target genes. The next day, when preparing pCas-Salmonella competent, add L-arabinose to induce the expression of λ-Red recombinase, and then transfer the pTAT-X plasmid, and spread the Kan+ / Amp+ plate. The homologous template and the target gene in the positive clone were double exchanged, and the wild-type clone was continuously cut double-stranded DNA by Cas9 mediated by X-N20sgRNA, making it difficult for the wild strain to grow. On the third day, a single clone was picked to identify the genome editing effect, and the successfully edited clone was added with IPTG to induce the expression of pMB1-N20sgRNA targeting the replicon of th...

Embodiment 4

[0132] Replacing the Salmonella VNP20009 eutC site with the RFP gene

[0133] The pTAT-eutC-RFP plasmid (SEQ ID NO: 3) was constructed. 636 bp in eutC-ORF (CP007804.2, 2,508,639~2,509,274) was replaced with RFP-ORF. Select 5'-ggcgctgttgcgcttcctgg-3' as eutC2-N20, and design primer pTA-eutC2-F (sequence is ggcgctgttgcgcttcctgggttttagagctagaaatagc) according to the selected N20 sequence to construct a targeting plasmid, thereby expressing the gene that can mediate Cas9 protein cleavage of the corresponding target site of msbB gene sgRNA. Primer pTA-eutC2-R / pTA-carrier-R amplification uses pTA plasmid as a template to PCR amplify the pTAT vector backbone; primer pTA-eutC2-F / pTA-carrier-F uses pTA plasmid as a template to amplify eutC2-sgRNA; primer eutC2-on-plasmid template-F / eutC2-on-RFP-R uses the Salmonella VNP20009 genome as a template to amplify the 301bp upstream homology arm of the eutC site; primers RFP-msbB-middle-F / RFP-msbB-middle-R to synthesize TagRFP The fragment ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a salmonella efficient traceless gene editing system and an application thereof. Lambda Red recombinase is used for promoting double exchange of template DNA and genome targetsites, through combination of a CRISPR / Cas9 system as a screening means, and through combination of a one-step method, homologous recombination is used for quickly constructing shooting plasmid, and insertion, replacement or knockout of genes can be realized. A homologous formwork is used for replacing the genome DNA, and other fragments are not remained. Genome editing can be completed within 3-4days, the experiment strength can be reduced, and the experiment cycle can be shortened.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a high-efficiency traceless gene editing system for Salmonella and its application. Background technique [0002] Salmonella is a common zoonotic pathogen and the most common pathogen in bacterial food infections in various countries. It can cause various syndromes such as gastroenteritis, typhoid fever, sepsis and extraintestinal focal infection. Transforming the Salmonella genome through genome editing technology to obtain strains with different genetic backgrounds will help to study the mechanism of Salmonella growth, reproduction and pathogenic process, and lay the foundation for prevention and treatment. Attenuated Salmonella can also be applied to tumor therapy, for example, the attenuated Salmonella VNP20009 strain has certain therapeutic effects on various tumors in animal models. Genetic modification of the Salmonella genome is an important means to further ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/22C12N15/113C12N15/74C12N15/90A61K35/741A61P35/00C12R1/42
CPCC12N9/22C12N15/113C12N15/74C12N15/902A61K35/741A61P35/00C12N2310/20C12N2800/80Y02A50/30A61K35/74C12N9/1241C12Y207/07047C12N15/11C12N15/102C12N2800/101C12N2800/40
Inventor 华子春李家璜韩超王萌慧周俊杰李静
Owner CHANGZHOU HIGH TECH RES INST OF NANJING UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More