Target DUSP6 related to myocardial infarction diagnosis and treatment and application thereof
A technology for myocardial infarction and cardiomyocytes, which is applied to the target DUSP6 and its application fields, can solve the problem of no effective treatment for reversing heart failure, and achieve the effects of reducing the risk of heart failure, improving cardiac function, and inhibiting the process of fibrosis.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0126] Example 1, Construction and Verification of Dusp6 Mutant Rats
[0127] 1. Construction of Dusp6 mutant rats
[0128] According to the method in the literature "Xinli Hu, Nannan Chang, Xuelian Wang, et al.Heritable gene-targeting with gRNA / Cas9 in rats. Cell Research (2013) 23:1322-1325.", a series of Dusp6 were constructed using the CRISPR system Mutant rat strains.
[0129] The specific construction method is as follows: 1. Design guide RNA according to the corresponding sequence on exon 1 of Dusp6 gene, and the gRNA sequence is AGGACCGGGACCGCTTTACCAGG; 2. The above gRNA and Cas9 mRNA are synthesized by in vitro transcription; 3. The synthesized product is microinjected into large Mouse embryos (Cas9 mRNA concentration is 40ng / uL, gRNA concentration is 20ng / uL); 4. Transplant the injected embryos into surrogate mother mice; 5. Take out the postnatal neonatal mouse genome, and clone and sequence the corresponding mutation sites. The sequences of the sequencing primers...
Embodiment 2
[0135] Example 2. Cardiac function improvement after myocardial infarction in Dusp6 mutant rats
[0136] 1. Preparation of myocardial infarction model
[0137] The myocardial infarction models of wild-type rats and Dusp6 mutant rats were established by ligation of the anterior descending coronary artery. Specific steps are as follows:
[0138] 1. Rats (body weight 200-250g) were anesthetized by intraperitoneal injection of 10% chloral hydrate (0.3mL / 100g), fixed their limbs and head on the operating table in a supine position.
[0139]2. Perform endotracheal intubation, connect the ventilator, and adjust parameters according to body weight. After observing that the rat's chest rise and fall were completely consistent with the frequency of the ventilator, the surgical field was disinfected with alcohol, and the skin was cut at the most obvious part of the left chest heart beat. The pectoralis major and serratus anterior were bluntly separated, and the intercostal muscles wer...
Embodiment 3
[0157] Example 3, DUSP6 protein is highly expressed in neutrophils
[0158] 1. DUSP6 protein is highly expressed in neutrophils in myocardial infarction tissue
[0159] In order to further study the cellular mechanism of improved cardiac function after DUSP6 deletion-induced myocardial infarction, it is necessary to determine the cellular localization and expression distribution of DUSP6. Prepare the wild-type rat myocardial infarction model according to the method in Example 2, digest the myocardial tissue of the wild-type rat 72h after the myocardial infarction into a single cell suspension, and then use different cell marker antibodies (cell marker: anti-cTnT (Abcam, ab8295) labeled cardiomyocytes, anti-Rat CD31-FITC (Abd Serotec, MCA1334F) labeled vascular endothelial cells, anti-α-SMA-FITC (Abcam, ab184675) labeled vascular smooth muscle and fibroblasts, anti-RatCD45- PE-Cy7 (BD Biosciences, 561588) labeled all immune cells, in which neutrophils were co-labeled with anti...
PUM
Property | Measurement | Unit |
---|---|---|
Thickness | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com