Coding sequence of opwrky2 transcription factor of snakeroot brevis and its application
A technology of short snake root grass and transcription factor, applied in the field of genetic engineering, can solve the problems of restricting the supply of camptothecin anticancer drugs, unable to meet market demand, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] Example 1: Cloning of the Snakeroot brevis OpWRKY2 gene
[0034] 1. Extraction of total RNA from Serpentis brevis
[0035] Take a small amount of young snakeroot leaves, quick-freeze them with liquid nitrogen, grind them quickly with a mortar, add them to a 1.5mL Eppendorf (EP) centrifuge tube filled with lysate, shake them thoroughly, and pump them according to the instructions of the TIANGEN kit. Extract total RNA. The RNA quality was checked by agarose gel electrophoresis, and then the RNA content was determined on a spectrophotometer.
[0036] 2. Cloning of Snakeroot brevis OpWRKY2 gene
[0037] Using the extracted total RNA as a template, cDNA was synthesized after reverse transcription; gene-specific primers were designed according to the sequence of the OpWRKY2 gene, as shown in Table 1, and the OpWRKY2 gene was amplified from the total cDNA by PCR amplification and sequenced.
[0038] Table 1 PCR primers
[0039] Primer name Primer sequence (5'-3...
Embodiment 2
[0041] Embodiment 2: Construction of the plant overexpression vector containing OpWRKY2 gene
[0042] The OpWRKY2 gene was constructed in the plant expression vector pCAMBIA2300 + Above, in order to facilitate the construction of the expression vector, the restriction site of Spe I was introduced into the forward primer, and the restriction site of BstE II was introduced into the reverse primer. The primers are shown in Table 2;
[0043] Table 2 pCAMBIA2300 + -PCR primers constructed by OpWRKY2 vector
[0044] Primer name Primer sequence (5'-3') OpWRKY2-SpeI-FP (SEQ ID NO.5) ACTAGTATGGAAAAGGTGAATGCTATTG OpWRKY2-BstEII-RP (SEQ ID NO.6) GGTCACCTCAGGAGATGTATGCAAT
[0045] In this implementation example, the transcription factor OpWRKY2, which is involved in the regulation of camptothecin synthesis, is operably linked to the expression control sequence, and the plant overexpression vector pCAMBIA2300 containing the OpWRKY2 gene is constructed. + -O...
Embodiment 3
[0046] Example 3: Agrobacterium rhizogenes-mediated genetic transformation of OpWRKY2 overexpression vector to obtain transgenic hairy roots of snakeroot
[0047] 1. Acquisition of engineered Agrobacterium rhizogenes containing OpWRKY2 gene overexpression
[0048] The plant expression vector containing the OpWRKY2 gene in Example 2 was transformed into Agrobacterium rhizogenes (such as C58C1, which is a publicly available biological material in the market) by the freeze-thaw method, and PCR verification was performed.
[0049] 2. Agrobacterium rhizogenes Mediated OpWRKY2 Gene Genetic Transformation of Serpentis brevis
[0050] 2.1 Pre-cultivation of explants
[0051] Stem segments were cut from healthy aseptic seedlings of Snakeroot brevis, placed on B5 medium for pre-cultivation, and cultured in dark at 25°C for 2 days.
[0052] 2.2 Co-cultivation of Agrobacterium and explants
[0053] Transfer the explants of the short snakeroot stem segments into the B5 medium suspension...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com