Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Coding sequence of ophiorrhiza pumila OpWRKY2 transcription factor and application of coding sequence

A short snakeroot and transcription factor technology, applied in the field of genetic engineering, can solve problems such as restricting the supply of camptothecin anticancer drugs and failing to meet market demand

Active Publication Date: 2020-06-23
ZHEJIANG CHINESE MEDICAL UNIVERSITY
View PDF9 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the single planting mode and the lack of germplasm resources severely restrict the supply of camptothecin anticancer drugs, which cannot meet the increasing market demand year by year

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Coding sequence of ophiorrhiza pumila OpWRKY2 transcription factor and application of coding sequence
  • Coding sequence of ophiorrhiza pumila OpWRKY2 transcription factor and application of coding sequence
  • Coding sequence of ophiorrhiza pumila OpWRKY2 transcription factor and application of coding sequence

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1: Cloning of the Snakeroot brevis OpWRKY2 gene

[0034] 1. Extraction of total RNA from Serpentis brevis

[0035] Take a small amount of young snakeroot leaves, quick-freeze them with liquid nitrogen, grind them quickly with a mortar, add them to a 1.5mL Eppendorf (EP) centrifuge tube filled with lysate, shake them thoroughly, and pump them according to the instructions of the TIANGEN kit. Extract total RNA. The RNA quality was checked by agarose gel electrophoresis, and then the RNA content was determined on a spectrophotometer.

[0036] 2. Cloning of Snakeroot brevis OpWRKY2 gene

[0037] Using the extracted total RNA as a template, cDNA was synthesized after reverse transcription; gene-specific primers were designed according to the sequence of the OpWRKY2 gene, as shown in Table 1, and the OpWRKY2 gene was amplified from the total cDNA by PCR amplification and sequenced.

[0038] Table 1 PCR primers

[0039] Primer name Primer sequence (5'-3...

Embodiment 2

[0041] Embodiment 2: Construction of the plant overexpression vector containing OpWRKY2 gene

[0042] The OpWRKY2 gene was constructed in the plant expression vector pCAMBIA2300 + Above, in order to facilitate the construction of the expression vector, the restriction site of Spe I was introduced into the forward primer, and the restriction site of BstE II was introduced into the reverse primer. The primers are shown in Table 2;

[0043] Table 2 pCAMBIA2300 + -PCR primers constructed by OpWRKY2 vector

[0044] Primer name Primer sequence (5'-3') OpWRKY2-SpeI-FP (SEQ ID NO.5) ACTAGTATGGAAAAGGTGAATGCTATTG OpWRKY2-BstEII-RP (SEQ ID NO.6) GGTCACCTCAGGAGATGTATGCAAT

[0045] In this implementation example, the transcription factor OpWRKY2, which is involved in the regulation of camptothecin synthesis, is operably linked to the expression control sequence, and the plant overexpression vector pCAMBIA2300 containing the OpWRKY2 gene is constructed. + -O...

Embodiment 3

[0046] Example 3: Agrobacterium rhizogenes-mediated genetic transformation of OpWRKY2 overexpression vector to obtain transgenic hairy roots of snakeroot

[0047] 1. Acquisition of engineered Agrobacterium rhizogenes containing OpWRKY2 gene overexpression

[0048] The plant expression vector containing the OpWRKY2 gene in Example 2 was transformed into Agrobacterium rhizogenes (such as C58C1, which is a publicly available biological material in the market) by the freeze-thaw method, and PCR verification was performed.

[0049] 2. Agrobacterium rhizogenes Mediated OpWRKY2 Gene Genetic Transformation of Serpentis brevis

[0050] 2.1 Pre-cultivation of explants

[0051] Stem segments were cut from healthy aseptic seedlings of Snakeroot brevis, placed on B5 medium for pre-cultivation, and cultured in dark at 25°C for 2 days.

[0052] 2.2 Co-cultivation of Agrobacterium and explants

[0053] Transfer the explants of the short snakeroot stem segments into the B5 medium suspension...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides a coding sequence of an ophiorrhiza pumila OpWRKY2 transcription factor and an application of the coding sequence. A coding frame sequence of the 1,071 bp OpWRKY2 transcription factor is isolated and cloned from ophiorrhiza pumila; a plant expression vector containing the OpWRKY2 gene is constructed, explants of ophiorrhiza pumila stem segments are subjected to genetic transformation, and ophiorrhiza pumila hairy roots overexpressing the OpWRKY2 gene are obtained; content of camptothecin in the transgenic hairy roots is analyzed by high-performance liquid chromatography and a results shows that overexpression of the OpWRKY2 gene can promote accumulation of the camptothecin in the ophiorrhiza pumila hairy roots; and a qRT-PCR analysis, a gel block experiment and a dual luciferase reporter gene experiment find that the OpWRKY2 transcription factor can combine and transiently activate expression of a camptothecin synthesis gene OpTDC1 and thus increase the accumulation of the camptothecin. The method provides a new type of high-quality medicine source for production of the camptothecin with a broad-spectrum anti-cancer effect, which has important theoretical significance and potential application value.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering and relates to a method for increasing the content of camptothecin in the hairy roots of Snakeroot brevis by using OpWRKY2 transcription factor. Background technique [0002] Ophiorrhiza pumila belongs to the genus Ophiorrhiza of Rubiaceae, and is a dicotyledonous perennial herb. The whole herb can be used as medicine. It is bitter and cold in nature and has the effect of clearing away heat and detoxifying. It is used by folks to treat high fever, whooping cough and traumatic infection. Snakeroot brevis is the medicinal source plant of Camptothecin (CPT) discovered after Camptotheca and Greencrisp. Camptothecin compounds are specific inhibitors of DNA topoisomerase I (Topo I), which can inhibit cell replication, growth and reproduction, and are a class of broad-spectrum anticancer drugs. It is clinically used to treat colon cancer, rectal cancer, ovarian cancer, etc. However, the si...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12N15/82C07K14/415A01H5/00A01H6/76
CPCC07K14/415C12N15/8243
Inventor 开国银张锡晨武超郝小龙
Owner ZHEJIANG CHINESE MEDICAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com