Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of long-chain non-coding RNA IncMGPF in regulation and control of muscle development functions of pigs

A long-chain non-coding, lv-lncmgpf technology, applied in the field of improving pig muscle mass, can solve the problem of less lncRNA identification, achieve low cost, improve production efficiency, and shorten the cycle

Active Publication Date: 2020-05-15
HUAZHONG AGRI UNIV
View PDF4 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, tens of thousands of lncRNAs have been identified in the pig genome by RNA-seq and other technologies, but the identification of lncRNAs in muscle is less

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of long-chain non-coding RNA IncMGPF in regulation and control of muscle development functions of pigs
  • Application of long-chain non-coding RNA IncMGPF in regulation and control of muscle development functions of pigs
  • Application of long-chain non-coding RNA IncMGPF in regulation and control of muscle development functions of pigs

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Example 1: Isolation and culture of porcine skeletal muscle satellite cells

[0052] Take a 1-day-old piglet (for example, the breed is Large White pig, but not limited to this breed) to kill by bleeding from the common carotid artery, and immerse it in 75% ethanol for 10 minutes to kill bacteria. Peel off the hindlimb muscles exposed by piglet skin, cut the muscle tissue with ophthalmic scissors, place 2% double antibody in phosphate buffered saline (PBS, dissolve 8g of NaCl, 0.2g of KCl, 2.89g of KCl in 750ml of ultrapure water Na 2 HPO 4 12H 2 O, 0.2 g NaH 2 PO 4 , dilute pure water to 1000mL) solution, rinse to remove hair, blood and fat. In the PBS solution with a double antibody concentration of 2%, thoroughly mince the muscle to 1mm 3 size. Collect in a 15mL centrifuge tube and centrifuge at 5000r / min for 2min. The PBS solution was discarded, and depending on the amount of muscle tissue precipitate, 2 times the volume of 2% collagenase was added, and the ...

Embodiment 2

[0053] Embodiment 2: Use RACE method to amplify and determine lncMGPF and its nucleotide sequence

[0054] Using porcine skeletal muscle satellite cell cDNA as a template, the RACE Rapid Amplification Kit of Takara Bioengineering Dalian Co., Ltd. (TAKARA) was used to operate according to the kit instructions. Design lncMGPF primers: 5'RACE primer: 5'-CCTGCCTCAAACCCCTCCTTTTACTCATCA-3', 3'RACE primer: 5'-ATTGCCAGCATTTGTAAGTGATTGTGCAAT-3'. The obtained amplified products were subjected to agarose gel electrophoresis, and the target bands were recovered and sequenced. The test results show that: through 5'RACE and 3'RACE amplification, the results show that the obtained sequence lncMGPF has a full length of 1586bp (see the sequence listing SEQ ID NO: 1 for its nucleotide sequence).

Embodiment 3

[0055] Example 3: Construction of lncMGPF overexpression and interfering lentiviral vector

[0056] Using pig skeletal muscle satellite cell cDNA as a template, design amplification primers according to the RACE sequencing results of Example 2, lncMGPF amplification full-length primers are as follows: forward primer F: GCTCTAGAGCAGAGCATTATTTTTCTTCTTCA; reverse primer R: CGGGATCCCGTGGCATTTACTTTTACTGGA.

[0057] Design siRNA sequence for lncMGPF nucleotide sequence, siRNA sequence primer is as follows: Forward primer F: CCGGAAGCATGAGGTCACTTAATATCTCGAGATATTAAGTGACCTCATGCTTTTTTTG; Reverse primer

[0058] R: AATTCAAAAAAAGCATGAGGTCACTTAATATCTCGAGATATTAAGTGACCTCATGCTT.

[0059] The amplified full-length lncMGPF sequence was connected to a lentiviral vector to obtain an overexpression vector PCDH-CMV-copGFP, which was named LV-lncMGPF. Further, the synthesized siRNA sequence was connected to the pLKO.1-TRC vector, and the recombinant vector was named LV-si-lncMGPF.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of animal genetic engineering, and particularly relates to application of long-chain non-coding RNA IncMGPF in regulation and control of muscle developmentfunctions of pigs. An over-expression vector and interfere vector of long-chain non-coding RNA IncMGPF are constructed, skeletal muscle satellite cells of the pigs are infected at a cellular level ina slow virus infection manner, biceps femoris muscles of the pigs are infected at a living level and are collected after being infected by viruses for multiple times, and the influences of IncMGPF onthe growth and development of the muscles are proved according to the individual pig, so that a technical basis is laid for the cultivation of new species of pork-type pigs with higher yield.

Description

technical field [0001] The invention belongs to the technical field of animal genetic engineering, and specifically relates to the application of a long-chain non-coding RNA lncMGPF sequence in promoting the differentiation of pig skeletal muscle satellite cells and improving pig muscle mass. Background technique [0002] Muscle growth and development is a complex long-term dynamic process, which is mainly divided into prenatal muscle development and postnatal growth stages. Muscle tissue is mainly composed of muscle fibers. A large number of studies have shown that the number of muscle fibers in animals has been determined before birth, and muscle mass is mainly determined by the number and size of muscle fibers. Therefore, the size of muscle fibers directly determines the meat yield, and it is an effective method and the focus of research in this field to increase meat yield by regulating the hypertrophy of muscle fibers. [0003] Since the first lncRNA H19 was identified...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/867A01K67/027
CPCC12N15/113C12N15/86A01K67/0275C12N2310/11C12N2740/15043C12N2800/107A01K2207/05A01K2227/108A01K2267/02
Inventor 左波吕威
Owner HUAZHONG AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com