Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Artificially synthesized anti-insect protein mCry1Ia2 as well as preparation method and application thereof

An insect-resistant protein, artificially synthesized technology, applied in the field of genetic engineering and biological control, to achieve important economic value, reduce environmental pollution, and reduce the amount of use

Inactive Publication Date: 2020-05-05
黑龙江大鹏农业有限公司 +1
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The use of a single insect resistance gene often makes the corn borer resistant to Bt protein

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Artificially synthesized anti-insect protein mCry1Ia2 as well as preparation method and application thereof
  • Artificially synthesized anti-insect protein mCry1Ia2 as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Example 1 Synthesis of mCry1Ia2 gene

[0054] Through codon optimization, Cry1Ab, Cry1F and Cry1Ie were synthesized (the synthesis work was completed by Jinweizhi (Suzhou) Co., Ltd.), and then the first and second functional domains of Cry1Ab, the second functional domain of Cry1Ab, and the The third functional domain and the three domain fragments of Cry1Ie are spliced ​​together to form a new mCry1Ia2 DNA sequence with six domains, the nucleotide sequence of which is shown in SEQ ID NO.1. It is generally believed that: Bt protein is composed of three structural domains, domain I includes 250-300 amino acids at the N-terminal of the active insecticidal protein, and consists of seven α-helices, one of which is relatively hydrophobic and located in the structural domain Ⅰ center, surrounded by the remaining 6 α-helices. It has been proven that it is related to the toxicity of insecticidal proteins. The hydrophobic α-helix has the ability to insert into the midgut cell m...

Embodiment 2

[0055] Example 2 Expression of mCry1Ia2 gene in prokaryotic system and detection of product toxicity

[0056] In order to detect the in vitro expression of the modified mCry1Ia2 gene and its toxicity to the corn borer, we constructed a Bt prokaryotic expression vector. As required, add the NdeI endonuclease recognition site sequence AAGGAGATATACATA at the 5' end of the primer sequence, as shown in SEQ ID NO.3; add the XhoI endonuclease recognition site sequence GGTGGTGGTGCTCGAG at the 3' end, as shown in SEQ ID NO.4 shown. The designed primer sequence is: F: AAGGAGATATACATA TGGACAACAAACCCCAAC, as shown in SEQ ID NO.5; R: GGTGGTGGTGCTCGAG CATGTCCCGCTGCTCGAT, as shown in SEQ ID NO.6. The spliced ​​DNA is used as a template, and the primers added with adapters are used to amplify the mCry1Ia2 gene, and the gel extraction kit is used to recover and purify the mCry1Ia2 gene fragment. Digest pET30a with restriction endonucleases NdeI and XhoI, recover and purify. The two frag...

Embodiment 3

[0068] Example 3 Expression of mCry1Ia2 gene in transgenic plants and detection of toxicity of expression products

[0069] At the 5' and 3' ends of the primer sequence, respectively add the SmaI endonuclease recognition site sequence CTCTAGAGGATCCCC, as shown in SEQ ID NO.7; and TCGAGCTCGGTACCC, as shown in SEQ ID NO.8. The designed primers are: F: 5' CTCTAGAGG ATCCCC ATGGACAACAAACCCCAAC3', as shown in SEQ ID NO.9; R:5' TCGAGCTCGGTACCC CTACTACTCGAGTGTGGCAGT 3', as shown in SEQ ID NO.10, uses the synthesized mCry1Ia2 nucleotide sequence as a template, amplifies with primers with adapters, and recovers the target fragment with a gel recovery purification kit. At the same time, the plant expression vector pTF101 was digested with SmaI, and the pTF101 fragment after digestion was recovered and purified. The two fragments were ligated (In-Fusion HD cloning kit, Clontech) to construct the eukaryotic expression plasmid pTF101-mCry1Ia2 (the promoter is CaMV35S, and the marker g...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an artificially synthesized anti-insect protein mCry1Ia2. The invention further discloses a nucleic acid molecule of the protein, a recombinant vector, a host cell or a recombinant bacterium of the nucleic acid molecule. The invention further discloses application of the protein as well as the nucleic acid molecule, the recombinant vector, the host cell or the recombinant bacterium of the nucleic acid molecule, and the like in regulating and controlling anti-insect properties and insect killing performance of plants or improving the anti-insect properties of transgenicplants, and preparing insecticides or anti-insect preparations. In-vitro experiment shows that the transformed and synthesized Bt gene toxin production protein has a remarkable insect killing effect on ostrinia nubilalis. A constitutive promoter is adopted to construct a novel plant expression vector, an anti-insect gene mCry1Ia2 can be stably and efficiently expressed in monocotyledons, and furthermore, anti-insect transgenic plants can be produced.

Description

technical field [0001] The invention relates to the fields of genetic engineering and biological control, in particular to an artificially synthesized insect-resistant protein mCry1Ia2 and its preparation method and application. Background technique [0002] The Bt gene encodes an insecticidal crystal protein, which is derived from Bacillus thuringiensis. It is widely found in water, soil, deserts, leaves, and insect corpses. It is the largest and most widely used biological insecticide today. When it forms spores, it can form insecticidal crystal protein (ICP), also known as δ-endotoxin, which can produce specific insecticidal activity against agricultural pests such as Lepidoptera and Coleoptera. The action process includes engulfment of the protoxin by the insect body, enzymatic hydrolysis and activation of the protoxin, passage of the toxin through the peritrophic membrane, binding of the toxin to specific receptors, insertion of the toxin molecule into the epidermal cel...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N15/62C12N15/70C12N1/21A01N47/44A01P7/04C12N15/82A01H5/00A01H6/46C12R1/19
CPCC07K14/325C12N15/70A01N47/44C12N15/8286C07K2319/00C12N2800/22Y02A40/146
Inventor 于壮岳莉莉
Owner 黑龙江大鹏农业有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com