Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Construction method and application of AAV vector for specific expression of CRE in mouse hippocampus CA2 region

A construction method, mouse technology, applied in the field of genetic engineering

Active Publication Date: 2020-03-24
SOUTHEAST UNIV
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The Cre recombinase carrier driven by the Map3k15 promoter constructed by the present invention, combined with the application of DIO-EGFP, DIO-chemical elements and DIO-optogenetic elements, solves the problem of effectively marking and tracing neurons in the CA2 region and effectively controlling the activity of nerve cells The problem

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method and application of AAV vector for specific expression of CRE in mouse hippocampus CA2 region
  • Construction method and application of AAV vector for specific expression of CRE in mouse hippocampus CA2 region
  • Construction method and application of AAV vector for specific expression of CRE in mouse hippocampus CA2 region

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1: Cloning of the Map3k15 promoter fragment

[0035] (1) DNA extracted from mouse brain (Qiagen DNeasy Blood and Tissue Kit, Catalog No.69504) was used as a template to amplify fragments of different lengths at the 5'-end of Map3k15 (Takara PrimerSTAR HS DNA polymerase, Catalog No. R010A).

[0036] A 3639bp fragment at the 5'-end of Map3k15 was amplified, which also included a part of Exon1 369bp downstream of the start codon. Use primer pairs:

[0037]Map3kpromo-F2:aggttggctgcaaactcact;

[0038] Map3kpromo-R: atcgtagaaggcatcgagcac;

[0039] Simultaneously amplify the 2293bp Map3k15 5'-terminal promoter fragment in the same way, using the primer pair:

[0040] Map3kpromo-F: gctggaactagggaaggatttc;

[0041] Map3kpromo-R: atcgtagaaggcatcgagcac;

[0042] At the same time, the 499bp Map3k15 5'-terminal promoter fragment was amplified in the same way, and the primer pair was used:

[0043] Map3kpromo-F3:ggaggaagtcaggggagggaggaaa;

[0044] Map3kpromo-R3: gcgggg...

Embodiment 2

[0047] Embodiment 2: Determination of Map3k15 activation efficiency

[0048] The three Map3k15 5'-end amplified fragments were subcloned into pGL4.0 plasmid respectively, using a non-ligase-dependent multi-fragment one-step cloning technique (Vazyme, ClonExpress MultiS One Step Cloning Kit, C113-02) and the following primer pairs :

[0049] 3639bp fragment

[0050] Map3k15-F2-Pgl4.1-F2: cctgagctcgctagcctcgagAGGTTGGCTGCAAACTCACTATG

[0051] Map3k15-R-Pgl4.1-R: cagtaccggattgccaagcttATCGTAGAAGGCATCGAGCACG

[0052] 2219bp fragment

[0053] Map3k15-F-Pgl4.1-F: cctgagctcgctagcctcgagGCTGGAACTAGGGAAGGATTTC

[0054] Map3k15-R-Pgl4.1-R: cagtaccggattgccaagcttATCGTAGAAGGCATCGAGCACG

[0055] 499bp fragment

[0056] Map3k15-F3-Pgl4.1-F: cctgagctcgctagcctcgagGGAGGAAGTCAGGGAGGGAGGAAA

[0057] Map3k15-R3-Pgl4.1-R: cagtaccggattgccaagcttGCGGGGCTGGCGGCTTCGAA

[0058] The multiple cloning sites of pGL4.0 are XhoI (5'-end) and HindIII (3'-end).

[0059] (2) Plasmid-transfected cells:

[0...

Embodiment 3

[0077] Embodiment 3: Construction of rAAV-Map3k15-Cre plasmid vector

[0078] Using the rAAV-EF1α-NLS-Cre-WPRE-pA (Wuhan Privy Brain Science and Technology Co., Ltd., #143) plasmid as the vector backbone, the 499bp fragment of Map3k15 was cloned into MluI and SalI two enzyme cutting sites. Use primer pairs:

[0079] 143-map-F3-F:gttcctgcggccgcacgcgtGGAGGAAGTCAGGGAGGGAGG

[0080] 143-map-F3-R:ttcttgggggccatgtcgacGCGGGGCTGGCGGCTTCG

[0081] get as figure 2 The indicated plasmid vector was sent to Wuhan Privy Science and Technology Co., Ltd. for virus packaging.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a construction method and application of an AAV virus vector capable of specifically expressing Cre recombinase in a hippocampus CA2 region of a mouse. The construction method comprises following steps: a partial promoter region of a mouse hippocampus CA2 specific expression gene Map3k15 is intercepted to be connected with Cre recombinase and cloned to a pAAV vector withoutan initial promoter. The constructed AAV vector with the Map3k15 promoter connected with Cre recombinase can effectively realize specific overexpression of Cre recombinase in the hippocampus CA2 region of a mouse so as to realize specific regulation and control of neuron activity in the CA2 region; a CA2 neuron tracing and regulating system independent of Cre transgenic mice is established, an effective tool is provided for researching functions of the CA2 region, and a basis is provided for subsequent research on CA2 functional molecular mechanism.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a construction method and application of an AAV vector specifically expressing CRE in the CA2 region of mouse hippocampus. Background technique [0002] The harm to society and family caused by neurological diseases such as cognitive impairment, autism and senile dementia is attracting more and more attention from society and individuals. At present, our understanding of the nervous system is still in the exploratory stage, and our understanding of the functions and neural circuits of various brain regions and different nerve cells in mammals is very limited. [0003] Many studies have known that the hippocampus is a brain region that has an important impact on cognition, learning, memory, and social interaction. In recent years, the CA2 region of the hippocampus has been confirmed to be related to social memory, but its molecular mechanism is still unclear. In order...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/864C12N15/64C12N15/65C12N15/113
CPCC12N15/86C12N15/64C12N15/65C12N9/12C12Y207/11025C12N2750/14143C12N2800/30C12N2830/008
Inventor 李默怡彭思琦庄燕谢维张俊吕曜辰
Owner SOUTHEAST UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com