Dihydrolipoic acid dehydrogenase mutant P213R and application thereof in synthesis of poly-gamma-glutamic acid of bacillus licheniformis
A technology of Bacillus licheniformis and dihydrolipoic acid, which is applied in the fields of enzyme engineering and genetic engineering
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Construction of Bacillus licheniformis WX-P213R with mutation of dihydrolipoic acid dehydrogenase gene:
[0030] 1. The dihydrolipoic acid dehydrogenase gene P213R (shown in SEQ ID NO.2) mutated through gene synthesis sequence according to the genomic DNA sequence of Bacillus licheniformis WX-02; using the genomic DNA of Bacillus licheniformis WX-02 as a template , PCR amplifies the upstream homology arm of the PdhD gene (primers are T2-F1 and T2-R1) and the downstream homology arm of the PdhD gene (primers are T2-F2 and T2-R2);
[0031] T2-F1:GACGACAATACAGATGAAGT
[0032] T2-R1: AAATCTCCTACTACCATTACATTACGCCTCCATTA
[0033] T2-F2: TAATGGAGGCGTAATGTAATGGTAGTAGGAGATTT
[0034] T2-R2: TAACAACGAAATAGTGGC 2. Connect the upstream homology arm of the PdhD gene, the dihydrolipoic acid dehydrogenase mutant P213R gene and the downstream homology arm of the PdhD gene by overlap extension PCR to form a target gene fragment. The arrangement order of the gene fragments is: the ups...
Embodiment 2
[0044] Application of dihydrolipoic acid dehydrogenase mutant strain WX-P213R in improving poly-γ-glutamic acid fermentation yield:
[0045] Fermentation Product Yield Analysis
[0046] The Bacillus licheniformis WX-P213R bacterial strain obtained in Example 1 was inoculated into LB medium, and cultivated for 14 hours at 37° C.; 50 mL of poly-γ-glutamic acid fermentation medium was loaded into a 500 mL Erlenmeyer flask, and then the seeds were cultured The bacterial solution is inoculated into the fermentation medium with an inoculum amount of 3% (volume percentage). The culture conditions are 230 r / min, 37° C., and 36 hours of fermentation period.
[0047] In this embodiment, for different fermentation medium formulations, the influence of Bacillus licheniformis WX-P213R on the synthesis level of poly-γ-glutamic acid was investigated (also inoculate Bacillus licheniformis WX with the same inoculum amount in these 24 kinds of media at the same time -02 as a contrast), 24 gro...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap