Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Method for improving expression quantity of 5-aminolevulinic acid

A technology of aminolevulinic acid and expression, applied in the field of genetic engineering, can solve the problems of host cell metabolic imbalance and reduce the synthesis level of target products, etc.

Active Publication Date: 2022-04-19
INST OF ANIMAL SCI OF CHINESE ACAD OF AGRI SCI
View PDF11 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The abundance of key enzymes and the amount of cofactors in the metabolic process need to be properly balanced, and the synthesis of cofactors also needs to be increased when the enzyme protein is overexpressed; however, when the concentration of cofactors is too high, it will cause metabolic imbalance in the host cell, which will reduce the production of the target product. Synthesis level (Lv Xueqin, Acta Bioengineering, 2021, 37(5): 1619-1636)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for improving expression quantity of 5-aminolevulinic acid
  • Method for improving expression quantity of 5-aminolevulinic acid
  • Method for improving expression quantity of 5-aminolevulinic acid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] 1. pykA Plasmid construction for overexpression

[0023] 1.1 pykA codon optimization

[0024] optimization pykA sequence, filtered to pykA 2 new sequences of , named as pykA1, pykA2, and synthesized.

[0025] 1.2 pykA Construction of overexpression elements

[0026] by C. glutamicum ATCC 13032 chromosome as template, 2 pairs of primers (P tuf -F:5- GTTCCTGGGCTTT GAGCA TGGCCGTTACCCTGCGA-3 and P tuf -R:5- TGCTTAATTAATGCTGAGATGTTTAAACCAT TGTATGTCCTCCTGGACTTC-3,T sod -F: 5- GTTTAAACATCTCAGCATTAATTAA GCATTTTTTAGTACGTGCAATAACC-3 and T sod -R: 5-GCCCATCCGTAAATTCTCGCTTGCCACAGCTGGCCT-3 respectively amplifies the strong promoter P tuf , terminator T sod , the PCR products were named as P tuf , T sod 。 with P tuf -F and T sod -R is a primer, and the PCR product P is generated by Overlap-PCR tuf , T sod Fusion is carried out to obtain the expression cassette P for overexpression of foreign genes tuf / T sod .

[0027] 2. wxya Construction of ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of gene engineering, in particular to a method for increasing the expression quantity of 5-aminolevulinic acid. The method comprises the following steps: overexpressing an ALA synthetase gene hemA and a coding gene pykA of pyridoxal kinase in corynebacterium glutamicum. According to the invention, by optimizing the hemA sequence, the ALA synthesis level is improved; meanwhile, the sequence of a key gene pykA in a synthetic route of a cofactor required by ALA synthetase is optimized and is subjected to overexpression, and a pykA sequence contributing to remarkably improving the ALA synthesis level is screened out.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a method for increasing the expression of 5-aminolevulinic acid. Background technique [0002] 5-Aminolevulinic acid (5-Aminolevulinic acid, 5-ALA) is a non-protein amino acid widely present in animal, plant and microbial cells. precursor. 5-ALA has important applications in many fields and has broad application and market development prospects. For example, in the feed industry, it can be used as an animal feed additive to promote animal health and growth; in the agricultural field, it can be used as a bio-fertilizer additive to promote disease resistance and yield increase of crops; Dynamic diagnosis and treatment, etc. [0003] With the development of biotechnology, especially the emergence of gene editing technology and the concept of synthetic biology, rationally modifying microorganisms to greatly increase the production of target substances is an inevitable trend of d...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21C12N15/53C12N15/54C12R1/15
CPCC12N9/0016C12N9/1029C12N9/1205C12Y104/01002C12Y203/01037C12Y207/01035C12N2800/22C12N2800/101
Inventor 黄火清刘波张红莲徐欣欣王苑杨浩萌涂涛柏映国罗会颖姚斌
Owner INST OF ANIMAL SCI OF CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com