Anti-IL-1beta (anti-interleukin-1beta) antibody as well as medicine composition and application thereof

An antibody drug, antibody technology, applied in the field of immunology, can solve the problem of inability to activate intracellular related signaling pathways

Inactive Publication Date: 2020-02-21
AKESO BIOPHARMA
View PDF5 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

IL-1R1 (also known as type1IL-1Receptor, IL-1R1 for short) is a transmembrane receptor that can combine with IL-1β and IL-1RAcP to form a receptor complex, activate downstream intracellular signaling pathways, mediate IL-1R2 has a higher affinity with IL-1β than IL-1R1. However, due to the short intracellular segment of IL-1R2, it cannot activate related intracellular signaling pathways after combining with IL-1β; IL-1R2 Soluble receptor forms exist for both -1R1 and IL-1R2 (Boraschi et al. Immunological Reviews. 281:197–232. (2018))

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-IL-1beta (anti-interleukin-1beta) antibody as well as medicine composition and application thereof
  • Anti-IL-1beta (anti-interleukin-1beta) antibody as well as medicine composition and application thereof
  • Anti-IL-1beta (anti-interleukin-1beta) antibody as well as medicine composition and application thereof

Examples

Experimental program
Comparison scheme
Effect test

preparation example 1

[0177] Preparation Example 1: Fusion proteins human IL-1β-His, IL-1R1(1-332)-His, IL-1β-hFc and human IL-1β- Preparation of His-Bio

[0178] The protein sequences of human IL-1β (Genbank ID: NP_000567.1) and IL-1R1 (Genbank ID: NP_000868) were searched through the NCBI GenBank protein database. The amino acid sequences of human IL-1β and IL-1R1 were fused with the His tag sequence and the human IgG Fc purification tag sequence respectively; the above-mentioned fusion proteins were abbreviated as human IL-1β-His and IL-1R1(1-332) respectively -His, IL-1β-hFc.

[0179] The quality of protein samples was identified by SDS-PAGE.

[0180] use Sulfo-NHS-LC-Biotinylation Kit (Thermo scientific) was used to prepare biotinylated-conjugated human IL-1β-His protein samples (referred to as human IL-1β-His-Bio for short); refer to the instructions of the kit for specific preparation methods.

[0181] The above-mentioned fusion protein prepared was used in the following examples. ...

Embodiment 1

[0182] Example 1: Preparation of anti-IL-1β murine antibody 3H6

[0183] 1. Preparation of hybridoma cell line LT010

[0184] BALB / C mice (purchased from Guangdong Medical Experimental Animal Center) were immunized with human IL-1β-his as an antigen, and splenocytes from the immunized mice were fused with mouse myeloma cells to form hybridoma cells. Using IL-1β-His-Bio as an antigen, the hybridoma cells were screened by ELISA method to obtain hybridoma cells capable of secreting antibodies specifically binding to IL-1β-His-Bio. For the hybridoma cells screened by ELISA, the hybridoma cell line that can secrete the monoclonal antibody that can compete with the receptor IL-1R1(1-332)-His to bind to IL-1β-His-Bio was screened by competitive ELISA, and passed Stable hybridoma cell lines were obtained by limiting dilution method. The method of hybridoma cell preparation refers to the established methods (for example, Stewart, S.J., "Monoclonal Antibody Production", in Basic Met...

Embodiment 2

[0189] Example 2: Sequence Analysis of Anti-IL-1β Antibody 3H6

[0190] The mRNA was extracted from the LT010 cell line cultured in Example 1 according to the method of Cultured Cell Bacteria Total RNA Extraction Kit (Tiangen, Cat. No. DP430). According to Invitrogen III First-StrandSynthesis System for RT-PCR Kit Instructions Synthesize cDNA and perform PCR amplification. The PCR amplification product was directly cloned by TA, and the specific operation was carried out referring to the instructions of the pEASY-T1 Cloning Kit (Transgen CT101) kit.

[0191] The products of TA clones were directly sequenced, and the sequencing results were as follows:

[0192] Nucleic acid sequence encoding the heavy chain variable region of antibody 3H6: (354bp)

[0193] CAGGTGACCCTGAAGGAGAGCGGACCAGGAATCCTGCAGCCTAGCCAGACACTGAGCCTGACTTGCAGCTTCAGCGGCTTCAGCCTGAGCACAAGCGGAATGGGCGTGTCTTGGATCAGGCAGCCATCAGGAAAGGGACTCGAGTGGCTGGCTCACATCTACTGGGACGACGACAAGCGGTACAACCCCTCCCTGAAGAGCAGGCTGACCATCAGCAA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the field of immunology and relates to an anti-IL-1beta (anti-interleukin-1beta) antibody as well as a medicine composition and application thereof. Specially, the invention relates to the anti-IL-1beta antibody or an antigen binding fragment thereof. The heavy chain variable region of the antibody comprises HCDR1-3 (heavy chain complementary determining region 1-3) of which amino acid sequences are shown in SEQ ID NO:17-19 in the description respectively; and the light chain variable region of the antibody comprises LCDR1-3 (light chain complementary determining region 1-3) of which amino acid sequences are shown in SEQ ID NO:20-22 in the description respectively. The antibody provided by the invention is capable of effectively binding human IL-1beta, blocking binding of IL-1beta with a receptor IL-1R1 and inhibiting activation of a downstream signal channel of IL-1beta, and has the potential of preparing medicines for preventing and treating autoimmune diseases, cryopyrin-associated periodic syndromes of children and adults, systemic juvenile idiopathic arthritis, gouty arthritis, cardiovascular diseases or tumors.

Description

technical field [0001] The invention belongs to the field of immunology, and relates to an anti-IL-1β antibody, its pharmaceutical composition and its application. Specifically, the present invention relates to an anti-human IL-1β antibody; more specifically, the present invention relates to an anti-human IL-1β monoclonal antibody; particularly specifically, the present invention relates to an anti-human IL-1β antibody Humanized monoclonal antibodies. Background technique [0002] The interleukin-1 (Interleukin 1, IL-1) family consists of two pro-inflammatory factors (IL-1α and IL-1β) and an IL-1 receptor antagonist (IL-1 receptor antagonist, IL-1Ra), IL-1α IL-1β and IL-1β can effectively stimulate IL-1 receptor (IL-1Receptor), and IL-1Ra can adhere to the surface of IL-1 receptor to block signal transduction. IL-1β is mainly synthesized by monocytes and macrophages, and the precursor of IL-1β protein is cleaved by caspase-1 into an activated form. The IL-1 receptor famil...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C07K16/24C07K16/46C12N15/13C12N5/20A61K39/395A61K45/06A61P37/02A61P9/00A61P9/10A61P35/00A61P19/02A61P19/06
CPCC07K16/245C07K16/468A61K39/3955A61K45/06A61P37/02A61P9/00A61P9/10A61P35/00A61P19/02A61P19/06A61K2039/505A61K2300/00C07K2317/56A61P29/00C07K2317/76C07K2317/24C07K2317/92A61K39/395C07K16/24C07K16/46C07K19/00C07K16/244A61K47/6801C07K2317/565C07K2317/31C07K2317/622A61K47/6845A61P37/06C07K2317/21C07K2317/52
Inventor 李百勇夏瑜王忠民张鹏
Owner AKESO BIOPHARMA
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap