Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application and fixed-point knockout method of EMC3 gene

A targeted knockout and gene knockout technology, applied in applications, other methods of inserting foreign genetic materials, genetic engineering, etc., to achieve the effect of inhibiting JEV replication and improving accuracy

Inactive Publication Date: 2019-12-24
HUAZHONG AGRI UNIV
View PDF4 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

According to the literature survey, there is no research report on the involvement of EMC3 gene in mediating JEV replication

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application and fixed-point knockout method of EMC3 gene
  • Application and fixed-point knockout method of EMC3 gene
  • Application and fixed-point knockout method of EMC3 gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1: Construction of EMC3 gene knockout cell lines using gene editing technology

[0038] First, download the porcine EMC3 gene exon sequence (accession number: ENSSSCG00000011562.3) and the whole pig genome sequence (version number: Sus_scrofa.Sscrofa11.1) from the ensemble database (www.ensembl.org), and then, use sgRNAcas9 The software (www.biootools.com) designed the sgRNA targeting the porcine EMC3 gene (Table 1), and selected the best sgRNA according to the specificity evaluation results. The sgRNA ID was EMC3_A_47, and the target sequence was "CGATTGGCAGGACCACCCAGAGG". It does not have 1 and 2 base mismatched off-target sites ( figure 1 A).

[0039] Table 1 Software design and evaluation of sgRNA targeting porcine EMC3 gene

[0040]

[0041]

[0042] Further, based on the lenti-sgRNA-EGFP lentiviral vector as the backbone, design and synthesize sgRNA primers, as follows EMC3-sgRNA-F: 5′-caccgCGATTGGCAGGACCACCCAG-3′, EMC3-sgRNA-R: 5′-aaacCTGGGTGGTCCT...

Embodiment 2

[0055] Example 2: Absolute quantification and plaque experiments found that knocking out the EMC3 gene can significantly inhibit the replication ability of JEV in host cells

[0056] In order to detect whether knocking out the EMC3 gene can inhibit the replication of JEV in PK-15 cells, absolute quantification and plaque assay were used to detect the effects of two monoclonal cell lines, EMC3-KO#1 and EMC3-KO#16, on the replication of JEV. The specific experimental process is as follows:

[0057] First, multiple groups of EMC3-KO#1 and EMC3-KO#16 cells were inoculated at the same time, and PK-15 wild-type cells stably expressing Cas9 were set as the control group. When the confluence reaches about 50%, add the corresponding volume of JEV-RP9 wild-type virus to each well according to MOI=1, shake well and put it back into the cell culture incubator for culture, and change to 2% FBS medium for 2 hours to continue the culture. At different time points such as 12h, 24h, 36h, and ...

Embodiment 3

[0072] Example 3: Using immunofluorescence experiments to find that knocking out the EMC3 gene can significantly inhibit the expression of JEV-encoded protein in host cells

[0073] Furthermore, immunofluorescence assay was used to detect the expression of JEV-encoded gene NS3 at 12 hours after JEV infection of EMC3-KO#1 and EMC3-KO#16 cells. The specific experimental process is as follows:

[0074] Inoculate EMC3-KO#1 and EMC3-KO#16 cells, set PK-15 wild-type cells stably expressing Cas9 as a control, and when the confluence reaches about 90%, add a corresponding volume of JEV-RP9 wild-type cells to each well according to MOI=1 Type virus, after shaking well, put it back into the cell incubator for culture, and change to 2% FBS medium in the 2nd hour and continue to cultivate until the 12th hour. The cells at 12h were fixed with paraformaldehyde PFA, treated with 0.3% Tritonx-100, added blocking solution at room temperature for 1h, NS3 (JEV) primary antibody was incubated ov...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the biology field, and particularly relates to application and a fixed-point knockout method of an EMC3 gene. Through targeted modification of the EMC3 gene by a gene editingtechnology and change of basic groups of a coding region to cause frame shift mutation of the EMC3 gene, an EMC3 gene knockout cell line is obtained. Experiments prove that by changing a nucleotide sequence of the EMC3 gene in a swine kidney cell (PK-15) to delete EMC3 protein expression, and proliferation of Japanese encephalitis virus (JEV) can be interfered significantly, so that host cells canbe effectively protected against JEV infection invasion induced death. Multiple sequence alignment analysis finds that the EMC3 gene sequence is highly conservative in pigs, people and mice. Therefore, the EMC3 gene can be used as a gene editing target for resisting Japanese encephalitis or used for developing anti-JEV drugs.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to the application of EMC3 gene and its fixed-point knockout method. Background technique [0002] Various infectious diseases caused by pathogenic microorganisms have always been a major obstacle to the efficient development of the global pig industry. The economic loss of pig farming caused by infectious diseases in China is estimated to be as high as 40 billion yuan every year. Especially since 2018, African swine fever has been introduced into China, which has severely damaged the domestic pig industry. China is the world's largest pig breeding and pork consumer. The epidemic not only affects the pig industry, but also affects related international trade. How to effectively prevent and control the occurrence of diseases has always been the focus of animal husbandry. Although vaccination has played an important role in prevention and control, it has not been able to com...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N5/10C12N15/113C12N15/867C12N15/90A61K45/00A61P31/14
CPCA61K45/00A61P31/14C07K14/47C12N15/113C12N15/86C12N15/907C12N2310/20C12N2740/15043
Inventor 谢胜松赵书红李新云刘海龙王子畅赵长志肖天贺聂雄伟张金福阮进学韩晓松
Owner HUAZHONG AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com