Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

RAA primer, probe and method for detecting knopvelsiekte virus

A dermatological and nodular technology, applied in the fields of biochemical equipment and methods, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problems of inconvenient operation, high false positives, long detection technology time, etc., and achieve easy operation. , the effect of easy throughput and short detection time

Active Publication Date: 2019-12-20
CHINA ANIMAL HEALTH & EPIDEMIOLOGY CENT +1
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, all of the above methods are not suitable for field conditions or in quarantine stations, and require highly skilled employees and well-equipped laboratories; based on the shortcomings of existing detection technologies such as long time, inconvenient operation, and high false positives, providing a A kind of accurate, sensitive, easy and simple to operate, the RAA fluorescence method that is applicable to spot rapid detection LSD, is the problem that those skilled in the art need to solve urgently

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • RAA primer, probe and method for detecting knopvelsiekte virus
  • RAA primer, probe and method for detecting knopvelsiekte virus
  • RAA primer, probe and method for detecting knopvelsiekte virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Select the conserved sequence of nodular dermatosis virus LSDV002 gene for primer and probe design Find the corresponding full gene sequence in Genebank (www.ncbi.nlm.nih.gov), use DNASTAR software for homology analysis and Blast sequence analysis , the highly conserved sequence of nodular dermatosis virus LSDV002 gene screened out is as follows:

[0048] ATATTGTCTTGGATTTTTTCATCCTTATCCAAGACAGAATCGAACGGATTTAGGTTTCCAAACATGAAGGAGATAAGCTTTTGCATTGGAAACATTAATAATGAATACAAACTATATAATTAAATTACATAATCTAGCTATAAAAAATACACAACAT (SEQ ID NO. 1);

[0049] The highly conserved sequence obtained by screening was used as the target gene fragment for detection, and positive plasmids were synthesized, and primers and probes were designed and screened for detection.

[0050] The above nodular dermatosis virus LSDV002 gene conservative sequence commissioned Sangon Bioengineering (Shanghai) Co., Ltd. to synthesize a DNA plasmid with a size of 3106bp.

[0051] (1) Primer design

[0052] Design pri...

Embodiment 2

[0078] A kind of method that RAA fluorescence method detects LSDV virus, comprises the steps:

[0079] (1) Homogenize the tissue of the sample to be tested, extract nucleic acid according to the method of tissue extraction DNA, and store it at -20°C for later use; if the sample is whole blood, serum, or plasma, use steps such as lysis, magnetic bead enrichment, washing, and elution to extract nucleic acid ;

[0080] (2) Turn on the constant temperature fluorescent gene detector RAA-F1620 for preheating, and set the reaction parameters. The reaction parameters are set to 39°C, and the reaction time is 20 minutes;

[0081] (3) Add 13.7 μL of water to 25 μL of reaction buffer, 2.1 μL of upstream and downstream primers and 0.6 μL of probe at a concentration of 10 μM, mix well, add to RAA fluorescent basic reaction reagent and mix to obtain a reaction master mix;

[0082] (4) Add 2.5 μL of Mg to the cap of the reaction tube 2+ , fully mixing 4 μL of the nucleic acid extraction so...

Embodiment 3

[0147] Embodiment 3 actual sample detection

[0148] (1) The sequences of primers, probes and negative quality controls are the same as in Example 1.

[0149] (2) A total of 15 clinical samples from 1 to 15 in the experiment were provided by the National Center for Research on Exotic Animal Diseases;

[0150] (3) Sample extraction method:

[0151] Homogenize the tissue samples first, and then extract nucleic acid according to the Tiangen commercial tissue DNA extraction method; extract nucleic acid from serum and plasma by lysing, magnetic bead enrichment, washing, elution and other steps; store at -20°C for later use;

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer, a probe and a method for detecting knopvelsiekte virus by a RAA fluorescence method. The primer and the probe are suitable for the detection by the RAA fluorescence method, can accurately detect knopvelsiekte virus plasmids without cross reaction with mycoplasma, bovine infectious rhinotracheitis virus, bovine viral diarrhea virus, bovine parainfluenza virus, bovine respiratory syncytial virus, goat pox virus and sheep pox virus, and have a specificity of 100%. The method is fast and easy to achieve high throughput, and can reduce time and cost for detection.The method for rapid detection of DNA of the knopvelsiekte virus based on the RAA fluorescence method has high sensitivity reaching 10 copies / reaction.

Description

technical field [0001] The invention belongs to the technical field of virus detection, and in particular relates to a RAA primer probe and a detection method for detecting nodular skin disease virus. Background technique [0002] Nodular dermatosis (Knopvelsiekte, LSD) is a bovine pox disease that, like sheep pox, is a systemic infectious disease caused by members of the genus Cappovirus; it is characterized by fever, skin, mucous membranes, and internal organs Nodules appear, the body becomes emaciated, lymph nodes enlarge, skin edema, and sometimes death occurs. The disease can damage hides and reduce production performance, especially for dairy cows. It has been recognized as a cross-border disease listed by OIE and is therefore of great economic importance. The genome of LSD virus (LSDV) comprises double-stranded DNA approximately 150,000 base pairs (bp) long. The geographical distribution of LSDV is different from that of sheep pox and goat pox. The strains of LSD ar...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/6844C12N15/11
CPCC12Q1/701C12Q1/6844C12Q2531/119C12Q2563/107
Inventor 吴晓东樊晓旭李林南文龙赵洋蔡禹希郭利川应清界吴发兴
Owner CHINA ANIMAL HEALTH & EPIDEMIOLOGY CENT
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com