Glucose dehydrogenase gld gene of Leaperia bancroft and its amplification primer combination and cloning method

A technology of glucose dehydrogenase and Bencroft's jumping bee, which is applied in the fields of botany equipment and methods, biochemical equipment and methods, genetic engineering, etc., and can solve the problems of no sequence upload record, literature report, etc.

Active Publication Date: 2022-03-15
ZHEJIANG ACADEMY OF AGRICULTURE SCIENCES
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, there is no relevant research report on the GLD gene of Leaperia bancroft. The sequences of GLD genes of other parasitoids in the NCBI database are also predicted sequences, and there are no accurate sequence upload records and related literature reports.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Glucose dehydrogenase gld gene of Leaperia bancroft and its amplification primer combination and cloning method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] (1) Extraction of Genomic DNA of Leaperia bancroft

[0043] Genomic DNA was extracted from 5 whole female adults of L. bancroftensis. The extraction method was carried out according to the instructions of the Genomic DNA Kit kit from TIANamp Company.

[0044] (2) Design of primers for the CDS region sequence of the GLD gene of Leaperia bancroft

[0045] According to the existing GLD gene transcriptome data of Leaperia bancrofti in our laboratory, and referring to the predicted GLD gene sequence of Leaperia bancroftensis in the NCBI database (GenBank accession number: XM_016982053), the Prediction of the CDS region of the GLD gene of A. japonica, and design of primers for the predicted sequence, the designed primer sequence is as follows: Design an upstream amplification primer (A-Gld-p1F: ctcgcagtacactcgcaaac) within 130 bp before the start codon (sequence is as follows) , and a downstream primer (A-Gld-p2R: aacaggttggagtgcgagag) was designed on the exon about 130 bp a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides the glucose dehydrogenase GLD gene of H. bancroft and its amplification primer combination and cloning method, belonging to the technical fields of molecular biology and gene cloning. The nucleotide sequence of the GLD gene is shown in SEQ ID No.6. The acquisition of this gene can further study the composition and gene structure of the gene in the cells of Leaperia bancrofti, and provide a theory for its function and functional region location in the reproductive physiology of Leaperia banecroft, as well as the difference from other species in accordance with.

Description

technical field [0001] The invention relates to the technical fields of molecular biology and gene cloning, in particular to the glucose dehydrogenase GLD gene of Leapers bancroft and its amplification primer combination and cloning method. Background technique [0002] Glucose dehydrogenase (GLD) is a class of small peptide molecules with diverse structures and functions, with a molecular weight of about 2Kbp and an isoelectric point between 5 and 7. The gene is widely distributed in arthropods. In egg and larval stages, the gene is distributed in many epidermis-derived tissues of insects, including some reproductive organs of the body wall; however, in the adult stage, the gene is only conserved in some reproductive organs. In organs such as spermatheca. For parasitoid females, the number of sperm absorbed and released is closely related to the number of fertilized eggs. The GLD gene can improve the fertilization ability of females by affecting the storage and release of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/53C12N9/04C12N15/11C12N15/10
CPCC12N9/0006C12Y101/9901C12Q1/686C12Q2521/101
Inventor 张娟黄俊吕要斌唐娅媛李明江
Owner ZHEJIANG ACADEMY OF AGRICULTURE SCIENCES
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap