Glucose dehydrogenase gld gene of Leaperia bancroft and its amplification primer combination and cloning method
A technology of glucose dehydrogenase and Bencroft's jumping bee, which is applied in the fields of botany equipment and methods, biochemical equipment and methods, genetic engineering, etc., and can solve the problems of no sequence upload record, literature report, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] (1) Extraction of Genomic DNA of Leaperia bancroft
[0043] Genomic DNA was extracted from 5 whole female adults of L. bancroftensis. The extraction method was carried out according to the instructions of the Genomic DNA Kit kit from TIANamp Company.
[0044] (2) Design of primers for the CDS region sequence of the GLD gene of Leaperia bancroft
[0045] According to the existing GLD gene transcriptome data of Leaperia bancrofti in our laboratory, and referring to the predicted GLD gene sequence of Leaperia bancroftensis in the NCBI database (GenBank accession number: XM_016982053), the Prediction of the CDS region of the GLD gene of A. japonica, and design of primers for the predicted sequence, the designed primer sequence is as follows: Design an upstream amplification primer (A-Gld-p1F: ctcgcagtacactcgcaaac) within 130 bp before the start codon (sequence is as follows) , and a downstream primer (A-Gld-p2R: aacaggttggagtgcgagag) was designed on the exon about 130 bp a...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com