Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Light-controlled protein degrading system and construction method, and light adjusted and controlled protein degrading method

A protein degradation and light regulation technology, applied in chemical instruments and methods, biochemical equipment and methods, cells modified by introducing foreign genetic material, etc. Issues such as lack of adjustability

Pending Publication Date: 2019-12-10
TIANJIN UNIV
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] 1) The applicability is poor, and the degradation of specific proteins can be achieved by modifying specific tools;
[0005] 2) Lack of adjustability, it is difficult to control the initiation and degree of protein degradation
[0007] Through the search, no patent publications related to the patent application of the present invention have been found

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Light-controlled protein degrading system and construction method, and light adjusted and controlled protein degrading method
  • Light-controlled protein degrading system and construction method, and light adjusted and controlled protein degrading method
  • Light-controlled protein degrading system and construction method, and light adjusted and controlled protein degrading method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0075] The construction of the light-controlled fusion protein (P-ScFv-Fc) gene sequence: taking green fluorescent protein as an example:

[0076] (1) The construction sequence of the P-vhhGFP4-Fc expression vector is SEQ.No.3, as follows:

[0077]gagtttctagacggagtactgtcctccgagcggagtactgtcctccgactcgagcggagtactgtcctccgatcggagtactgtcctccgcgaattccggagtactgtcctccgaagacgctagcggggggctataaaagggggtgggggcgttcgtcctcactctagatctgcgatctaagtaagcttggccaccatggatcaagtccaactggtggagtctggtggcgctttggtgcagccaggtggctctctgcgtttgtcctgtgccgcttctggcttcccagtgaaccgctattccatgcgctggtatcgccaggctccaggcaaagagcgtgagtgggtagccggtatgtccagcgcgggtgatcgtagctcctatgaagactccgtgaagggccgtttcaccatcagccgtgacgatgcccgtaacacggtgtatctgcaaatgaacagcttgaaacctgaagatacggccgtgtattactgtaatgtgaacgtgggcttcgagtattggggccaaggcacccaggtcaccgtctccagcgacaaaactcacacatgcccaccgtgcccagcacctgaactcctggggggaccgtcagtcttcctcttccccccaaaacccaaggacaccctcatgatctcccggacccctgaggtcacatgcgtggtggtggacgtgagccacgaagaccctgaggtcaagttcaactggtacgtggacggcgtggaggtgcataat...

Embodiment 2

[0080] To verify the efficiency of the light-controlled promoter, take green fluorescent protein as an example:

[0081] (1) Perform cell transfection experiments with P-vhhGFP4-Fc expression plasmids and GAVPO plasmids: plant the cells in a 12-well plate one day in advance, and use 25ul of serum-free medium with 1.2ug of DNA and 4ul of transfection reagent dilution. Stand at room temperature for 5 minutes; add the transfection reagent dilution to the DNA dilution, mix well, and let stand at room temperature for 15 minutes; add the transfection complex to the culture container containing cells and complete medium, and incubate for 4-6 hours Afterwards, the culture medium was replaced, and blue light (488nm, frequency 1Hz, power 0.75w) was illuminated for 24 hours, and then the cells were lysed, the protein was extracted, and the expression of the adapter protein was detected by immunoblotting under light and dark conditions. The experimental results were as follows: figure 2...

Embodiment 3

[0083] (1) Perform cell transfection experiments with P-vhhGFP4-Fc expression plasmids, GAVPO plasmids, GFP plasmids, and TRIM21 plasmids: plant cells in 12-well plates one day in advance, and use 1.2ug of DNA and 4ul of transfection reagents respectively Dilute in 25ul serum-free medium. Stand at room temperature for 5 minutes; add the transfection reagent dilution to the DNA dilution, mix well, and let stand at room temperature for 15 minutes; add the transfection complex to the culture container containing cells and complete medium, and incubate for 4-6 hours Afterwards, the medium was replaced, and the cultivation was continued for 24-48h.

[0084] (2) Set up the control group (only transfection of GFP and empty vector) and the experimental group (transfection of P-vhhGFP4-Fc plasmid, GAVPO plasmid, GFP plasmid, TRIM21 plasmid) to set up the dark group and the light group respectively, and the light group is set according to 488nm, After 24 hours of light at a frequency o...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a light-controlled protein degrading system. The system comprises p-vhhGFP4-Fc, GAVPO and TRIM21 plasmid expression vectors, wherein the GAVPO is a light-controlled promoter constituent part, the TRIM21 is a kind of E3 ubiquitin ligase which can recruit proteasome and participate in a ubiquitination degradation pathway, and the p-vhhGFP4-Fc is a kind of fusion protein which can express vhhGFP4-Fc fusion protein under the illumination condition and induce GFP to generate degradation. The system can degrade particular protein in cells through adjusting illumination time,illumination frequency and illumination intensity, and is simple and efficient.

Description

technical field [0001] The invention belongs to the field of biotechnology, in particular to a light-regulated protein degradation system, a construction method and a method for light-regulated protein degradation. Background technique [0002] Regulating the expression of intracellular proteins is an effective way to affect the life activities of cells. In the past, there are mainly two kinds of regulation methods: 1) at the DNA level, gene modification is carried out through gene knockout, gene editing and other technologies, Then regulate the protein encoded by the modified gene. 2) At the RNA level, the mRNA transcribed by a gene is silenced by SiRNA, thereby inhibiting the expression of a specific protein. However, these two regulation methods are indirect regulation, and these methods are used to regulate intracellular proteins The longer time required for the content may result in the cells having sufficient time to activate compensatory mechanisms. [0003] Degradin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/85C12N15/66C12N5/10
CPCC12N15/85C12N15/66C07K14/43595C12N9/93C12Y603/02019C07K2319/30
Inventor 王汉杰郝亚锋常津潘惠卓李佳桦崔梅慧
Owner TIANJIN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com