Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

F. oxysporum TOR gene RNAi vector, and method for prevention and treatment of potato dry rot and fusarium wilt through combination of F. oxysporum TOR gene RNAi vector and salicylic acid

A technology for Fusarium oxysporum and dried potato, which is applied in the fields of molecular biology and plant disease control to achieve the effects of reducing plant fusarium wilt and dry rot, weakening pathogenicity, maintaining balance and sustainable development

Active Publication Date: 2019-11-19
INST OF URBAN AGRI CHINESE ACADEMY OF AGRI SCI +1
View PDF7 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, it has not been reported whether salicylic acid directly enters the pathogenic bacteria and kills the pathogenic bacteria by inhibiting the activity of key target proteins.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • F. oxysporum TOR gene RNAi vector, and method for prevention and treatment of potato dry rot and fusarium wilt through combination of F. oxysporum TOR gene RNAi vector and salicylic acid
  • F. oxysporum TOR gene RNAi vector, and method for prevention and treatment of potato dry rot and fusarium wilt through combination of F. oxysporum TOR gene RNAi vector and salicylic acid
  • F. oxysporum TOR gene RNAi vector, and method for prevention and treatment of potato dry rot and fusarium wilt through combination of F. oxysporum TOR gene RNAi vector and salicylic acid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Embodiment 1, phytohormone salicylic acid (SA) inhibits the hyphal growth and pathogenicity of Fusarium oxysporum 1. Process Fusarium oxysporum on a plate with different concentrations of SA

[0022] Prepare PDA plates with different concentrations of SA of 0.5mmol / L, 1mmol / L, 5mmol / L, 10mmol / L, and 15mmol / L under sterile conditions. PDA medium was placed in the middle of the plate. After sealing, they were cultured in a fungal incubator at 25°C, and each treatment was replicated at least three times. After culturing Fusarium oxysporum for 5 days, observe and count the diameter of fungal hyphae; at the same time, observe the mycelium morphology of Fusarium oxysporum after cultivating for 5 days under a scanning electron microscope, and the results are as follows: figure 1 Shown in B. According to the experimental results, it was found that with the increase of SA concentration, the mycelial growth was more and more inhibited, indicating that SA inhibited the growth of...

Embodiment 2

[0025] Example 2. Study on the pathogenicity of Fusarium oxysporum to potato after silencing the FoTOR gene of Fusarium oxysporum by siRNAs

[0026] 1. Design and synthesis of siRNAs against FoTOR

[0027] Using the yeast TOR protein as a reference to search the genome database of Fusarium oxysporum, it was found that Fusarium oxysporum contains two TOR genes, and their full-length CDS sequences are FoTOR1:7329bp; FoTOR2:5277bp. For the CDS sequence of FoTOR, the following siRNAs were designed and synthesized using siRNA design software. siRNA1: CCTTACAAACACCAGGTAATT (Seq ID No: 6); siRNA2: GCAAGATCCTGCTCAACATTT (Seq ID No: 7); siRNA3: GAGGTGGCGATGAAGAGAGTT (Seq ID No: 8); Negative control (Negative control, NC): TTCTCCGAACGTGTCACGTTT (Seq ID No: 9). siRNAs were synthesized at Sangon Bioengineering (Shanghai) Co., Ltd.

[0028] 2. siRNAs inoculation experiment

[0029] The synthetic siRNAs were mixed with the spore suspension of Fusarium oxysporum to inoculate potato leaves a...

Embodiment 3

[0030] Embodiment 3, Fusarium oxysporum TOR gene RNAi expression vector construction

[0031] The CDS sequences of FoTOR1 and FoTOR2 of Fusarium oxysporum were homologously compared in NCBI to find out the most suitable sequence for constructing RNAi interference vector, and the RNAi interference sequences of FoTOR1 and FoTOR2 were combined and named FoTOR12. The sequence of FoTOR12 is Seq ID No: 1 (the one without underline is FoTOR1, and the one with underline is FoTOR2):

[0032] CGATCCAGGAGAGACTACTTGATATGCTCAGCGTAGTTCTCTGCGGTGAGCCATTTAAACCCCTTGGCGCTCCACAACCAAATACTCTCAGCTCAGTCCCGATTATTCCCAAAGACGCAAAAGACCCCCACGCTTATGAGCACCGAAGGGCTGAGGTCAAGTTGGCGCTCAACACTCTCGGTAGTTTCGATTTCTCAGGACATGTTCTGAACGAGTTTGTTCGAGACGTCGCAATCAAGTACGTTGAAGACGAGGATCCAGAAATCCGTGAGGCAGCGGCCTTGACATGCTGCCAATTAT CACCACGCGGCTGTGATTGAAGCTATTATGAACATCTTCCGCACCCTGGGCTTGGAGTGTGTTTCGTTCCTT GATAGAATCATACCGGCATTCCTCCAGGTGATACGATCGGCCACTTCCACGAGACCCGAGTCTTACTTCAACCAAC TGGCCACTCTCGTCAGCATCGTGCGGCAACATATAAGAAATTATCTT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an F. oxysporum TOR gene RNAi vector. A plant expression vector pEarleyGate 303 serves as a skeleton vector, and the sequence shown as Seq ID No:3 is inserted at a recombination site. The invention further discloses a microbial transformant containing the RNAi vector, further discloses application of the RNAi vector to prevention and treatment of potato dry rot and fusariumwilt, and further discloses a method for combined prevention and treatment of potato dry rot and fusarium wilt. The method comprises the steps that the RNAi vector is transferred into potatoes to obtain transgenic potatoes, and the transgenic potatoes are treated through salicylic acid for prevention and treatment of dry rot and fusarium wilt. The F. oxysporum RNAi interference vector is successfully constructed, through combined use of a plant hormone, namely the salicylic acid, and an FoTOR12-RNAi transgene, the pathogenicity of F. oxysporum can be reduced very significantly, and the effective method is provided for prevention and treatment of plant fusarium wilt and dry rot caused by the F. oxysporum.

Description

technical field [0001] The invention relates to the technical fields of molecular biology and plant disease prevention and control, in particular to a Fusarium oxysporum TOR gene RNAi carrier and a method for controlling potato dry rot and wilt in combination with salicylic acid. Background technique [0002] Potato belongs to the herbaceous plant of Solanaceae, and its tubers are edible. It is the fourth most important food crop in the world after wheat, rice and corn. As an important potato producing country in the world, China has always ranked first in the world in terms of potato planting area and total output. It is estimated that by 2020, China's potato planting area will expand to more than 100 million mu, the average yield per mu will increase to 1300 kg, and the total output will reach 1.3 Therefore, the development of my country's potato industry will inevitably have an important impact on the world's potato industry. In 2015, the Ministry of Agriculture proposed ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/82C12N15/113A01H6/82A01N37/40A01P3/00
CPCA01N37/40C12N15/113C12N15/8218C12N15/8282C12N2310/14
Inventor 任茂智李林宣祝婷婷李付广
Owner INST OF URBAN AGRI CHINESE ACADEMY OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com