Application of bacillus licheniformis rex gene to increase of yield of poly gamma-glutamic acid
A technology of bacillus and bacillus licheniformis, applied in the field of genetic engineering and microorganisms, to achieve the effect of increasing the utilization rate of glycerol and increasing the yield
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Construction of Bacillus licheniformis rex Knockout Vector
[0032] Step 1: according to the upstream and downstream sequences of the rex gene (the protein encoded by this gene is shown in SEQ ID NO.3) in the bacillus licheniformis WX-02 genome DNA sequence, design the upstream homology arm primers (A-F and A-R), downstream homology arm primers (B-F and B-R); and using the genomic DNA of Bacillus licheniformis WX-02 as a template, carry out PCR amplification with the upstream homology arm primer and downstream homology arm primer of rex gene respectively to obtain rex The upstream homology arm of the gene (508bp, shown in SEQ ID NO.1) and the downstream homology arm of the rex gene (497bp, shown in SEQ ID NO.2);
[0033] Among them, the sequence of A-F, A-R, B-F, B-R is:
[0034] A-F: CGGGATCCGAATGAGTTTACACATTTTAATGA,
[0035] A-R: ATTTATTTTTCGTTTTCCGTTAAACTAATCCTCCATGTCTA,
[0036] B-F: TAGACATGGAGGATTAGTTTAACGGAAAACGAAAAATAAAT,
[0037] B-R: GCTCTAGAAAGCCCACAGCTGG...
Embodiment 2
[0044] Construction of rex knockout strains:
[0045] Step 1: Transform the integrated expression vector T2(2)-rex into Bacillus licheniformis WX-02, screen under the condition of 37°C and contain kanapenicillin resistance, and screen to obtain transformants, transformants Pick the plasmid for colony PCR verification (the primers used are: T2-F and T2-R). If the PCR verification result of the transformant is: an electrophoretic band occurs at 1323bp, it proves that the integrated expression vector T2(2)-rex is successfully transferred into Bacillus licheniformis WX-02, at this time, the transformant is a positive transformant ( That is, the Bacillus licheniformis WX-02 that has been transformed into the integrated expression vector T2(2)-rex);
[0046] Step 2: Transplant the positive transformants obtained in step 1 at 45°C on a medium containing kanapenicillin resistance for 3 times, each time for 12 hours, and use T2-F and rex-YR as primers Colony PCR detection of single e...
Embodiment 3
[0052] Application of Bacillus licheniformis WX-02△rex in high-yield poly-γ-glutamic acid:
[0053] 1) Seed fermentation: Activate Bacillus licheniformis WX-02 and Bacillus licheniformis WX-02△rex on the plate, pick the bacteria and inoculate them into 250mL Erlenmeyer flasks containing 50mL liquid LB respectively, and culture at 37°C and 230rpm for 10h. Then subsequently inoculate into the fermentation medium with an inoculum of 1% (volume ratio), and 50ml of fermentation medium is packed in a 250mL Erlenmeyer flask.
[0054] Described fermentation medium applicant has selected 9 kinds of culture medium formulas, numbering 1-9 is poly-gamma-glutamic acid fermentation culture medium (table 1), in addition, all comprises hydrogen phosphate dihydrogen phosphate in every culture medium Potassium 0.5g / L, calcium chloride 0.5g / L, magnesium sulfate 0.5g / L, ferric chloride 0.004g / L, manganese sulfate 0.5g / L.
[0055] Table 1 Medium formula for γ-PGA fermentation
[0056]
[0057...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com