Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

High-efficient accurate targeted gene integration system and application thereof

A targeting and gene technology, applied in the field of genetic engineering and biology, can solve the problems of low efficiency, lack of advantages, inconvenient experiments, etc., and achieve the effect of efficient gene integration

Active Publication Date: 2019-10-08
SOUTHERN MEDICAL UNIVERSITY
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Non-homologous end joining (NHEJ) and homologous recombination repair (HDR) are common DNA repair mechanisms when the body’s DNA is damaged. Among them, NHEJ is the main and HDR is the auxiliary. At present, the gene knock-in method is mainly based on the latter HDR mechanism, this method has the effect of precise gene editing, but there is a problem of low efficiency, which will bring great inconvenience to the experiment when gene integration is carried out on a large scale, so the present invention utilizes the NHEJ efficient repair mechanism
[0006] The existing non-viral integration system can achieve relatively precise gene positioning, which provides a guarantee for the safety of gene therapy in the future, while the virus integration system can achieve high-efficiency integration function, which determines the efficacy potential of gene therapy , but the two lack the advantages of each other, therefore, it is necessary to propose a gene integration system that can achieve efficient and precise targeting

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High-efficient accurate targeted gene integration system and application thereof
  • High-efficient accurate targeted gene integration system and application thereof
  • High-efficient accurate targeted gene integration system and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0076] Example 1 pCAG-SB100X-mChery plasmid ( figure 2 )Construct

[0077] Design and synthesize the SB100X-Template plasmid, the specific sequence is as follows:

[0078] ACCGGTGGTGGAGGCGGAGGTTCTGGGGGAGGAGGTAGTGGCGGTGGTGGTTCAGGAGGCGGCGGAAGCTTGGATCCAGGTGGAGGTGGAAGCGGTGTTAACATGGGAAAATCAAAAGAAATCAGCCAAGACCTCAGAAAAAGAATTGTAGACCTCCACAAGTCTGGTTCATCCTTGGGAGCAATTTCCAAACGCCTGGCGGTACCACGTTCATCTGTGCAAACAATAGTACGCAAGTATAAACACCATGGGACCACGCAGCCGTCATACCGCTCAGGAAGGAGACGCGTTCTGTCTCCTAGAGATGAACGTACTTTGGTGCGAAAAGTGCAAATCAATCCCAGAACAACAGCAAAGGACCTTGTGAAGATGCTGGAGGAAACAGGTACAAAAGTATCTATATCCACAGTAAAACGAGTCCTATATCGACATAACCTGAAAGGCCACTCAGCAAGGAAGAAGCCACTGCTCCAAAACCGACATAAGAAAGCCAGACTACGGTTTGCAACTGCACATGGGGACAAAGATCGTACTTTTTGGAGAAATGTCCTCTGGTCTGATGAAACAAAAATAGAACTGTTTGGCCATAATGACCATCGTTATGTTTGGAGGAAGAAGGGGGAGGCTTGCAAGCCGAAGAACACCATCCCAACCGTGAAGCACGGGGGTGGCAGCATCATGTTGTGGGGGTGCTTTGCTGCAGGAGGGACTGGTGCACTTCACAAAATAGATGGCATCATGGACGCGGTGCAGTATGTGGATATATTGAAGCAACATCTCAAGACATCAGTCAGGAAGTTAAAGCTTGGTCGCAAATGG...

Embodiment 2

[0091] Example 2 pCAG-Cas9-SB100X plasmid ( image 3 )Construct

[0092] Cut the pCAG-Cas9-mChery plasmid (see below for details) with AgeI+BsrGI restriction endonuclease ( figure 1 ) and the SB100X-Template plasmid, the enzyme product was analyzed by 0.8% agarose gel electrophoresis, the 8570bp and 1152bp bands were recovered by cutting the gel, and the concentration of the recovered fragment was determined by NanoDrop. The linearized pCAG-Cas9-mChery plasmid was combined with the SB100X- The template was ligated by T4 DNA ligase purchased from NEB Company (see below for details), and then the ligated product was transformed into TOP10 Escherichia coli, spread on an LB solid plate containing 100 μg / mL ampicillin, cultured overnight at 37°C, and then picked a single clone , 37 ℃ 250rpm shaking bacteria, extraction of plasmids for DNA sequencing, thus screening to construct the vector, named pCAG-Cas9-SB100X ( image 3 ).

[0093] Enzyme digestion system 50μL, including:

...

Embodiment 3

[0098] Example 3 pCAG-Cas9-N123 plasmid ( Figure 4 )Construct

[0099] PCR was carried out using the SB100X-Template plasmid as a template, and the PCR primer sequences were designed and synthesized as follows:

[0100] N57-123-OL-F: CAAGAAGAAGAGGAAGGTGACCGGTGGTGGAGGCGGAGGTTCTGG (SEQ ID NO: 4)

[0101] N123-OL-R: AGATCCCCGCGCTGCAGTTACTTGTACATATAGCGGCCGCTCAGAGCAGTGGCTTCTTC (SEQ ID NO: 5)

[0102] Cut the pCAG-Cas9-mChery plasmid (see below for details) with AgeI+BsrGI restriction endonuclease ( figure 1 ), use 0.8% agarose gel electrophoresis to analyze the enzyme product and PCR (see below) product, cut the gel and recover the 8570bp and 533bp bands respectively, and utilize NanoDrop to measure the concentration of the recovered fragment, and the linearized pCAG-Cas9-mChery plasmid Ligate the PCR product with the Gibsion Assembly ligation kit purchased from NEB Company (see below for details), then transform the ligated product into TOP10 Escherichia coli, spread it on an ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a high-efficient accurate targeted gene integration system and an application thereof. The high-efficient accurate targeted gene integration system comprises an expression exogenous fusion protein system, a guide RNA and a donor carrier, wherein the expression exogenous fusion protein system comprises a fusion protein formed by one of Cas9 or SB or Cas9 and SB, N123, N57 and SB100XE279D; the guide RNA is a long sequence of 20bp in a target genome region and two ends of the donor carrier; and two ends of the donor carrier guide RNA targeted sites, SB binding sites and middle target gene integration fragments are arranged at two ends of the donor carrier. Through the adoption of the high-efficient accurate targeted gene integration system disclosed by the invention, the targeting, the cutting and the integrating of gene can be simultaneously realized; and SB transposase is utilized to be combined with a transposon donor to form a tetramer, so that the donor carrier can be oriented to the target sites, and targeted integration of the gene is facilitated. According to the high-efficient accurate targeted gene integration system disclosed by the invention, in vivo linearization elements are utilized, so that in vitro linearization of the donor carrier can be realized, and the integration of the genes is facilitated; and the method for realizing gene typing isbased on the SB transposase and NHEJ in a gene repairing mechanism, so that the high-efficient accurate targeted gene integration system can realize gene integration efficiently.

Description

technical field [0001] The invention belongs to the field of genetic engineering and biotechnology, and relates to a precise targeted cutting target gene by CRISPR / Cas9, SB-specific binding guide donor carrier and high-efficiency gene integration to achieve high efficiency and precision in mammalian cells and mammalian bodies Construction and application of targeted gene integration system. Background technique [0002] The genetic material of human beings is DNA, which determines various characteristics of human beings. Due to various reasons, human genes have mutated, and many of them are unfavorable mutations, and are accompanied by the arrival of various genetic diseases. Therefore, it can be efficiently, safely and effectively Realizing gene repair is an important task for human survival and development, therefore, gene therapy has also attracted everyone's attention. The gene integration system is the basis of gene therapy. It is divided into two types, virus integrat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/90C12N15/85
CPCC12N15/85C12N15/907C12N2800/107
Inventor 荣知立林瑛马淑凤王新龙吕杰刘成芳
Owner SOUTHERN MEDICAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com