Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Eimeria tenella AN1-like Zinc finger domain-containing protein and application thereof in inhibiting invasion of coccidium

A technology of Eimeria and zinc finger protein, applied in the direction of immunoglobulin, immunoglobulin from serum, application, etc.

Active Publication Date: 2019-09-06
SHANGHAI VETERINARY RES INST CHINESE ACAD OF AGRI SCI
View PDF4 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, to date there has been no study on EtAN1-ZnFP

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Eimeria tenella AN1-like Zinc finger domain-containing protein and application thereof in inhibiting invasion of coccidium
  • Eimeria tenella AN1-like Zinc finger domain-containing protein and application thereof in inhibiting invasion of coccidium
  • Eimeria tenella AN1-like Zinc finger domain-containing protein and application thereof in inhibiting invasion of coccidium

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1 The acquisition of EtAN1-ZnFP gene and its functional analysis

[0037] Insect strain

[0038] The sporulated oocyst Shanghai strain of Eimeria tenella (resource number: CAAS21111601) was isolated and preserved by the protozoal disease innovation team of Shanghai Veterinary Research Institute, Chinese Academy of Agricultural Sciences.

[0039] RNA extraction and cDNA preparation

[0040] Total RNA was extracted from unsporulated oocysts using TRIzol reagent (TaKaRa, Tokyo, Japan) according to the instruction manual. Total RNA concentration was determined at 260 nm using a spectrophotometer (Eppendorf, Hamburg, Germany). RNA quality was assessed by electrophoresis on a 1% agarose gel. Complementary DNA (cDNA) was synthesized from total RNA of unsporulated oocysts using Super Script III RT reagent.

[0041] amplify

[0042]The ORF sequence of the EtAN1-ZnFP gene was amplified using the upstream primer 5'-ATGAGCTCAGAGCAACACG-3' (SEQ ID NO.1) and the downstre...

Embodiment 2

[0046] Example 2 EtAN1-ZnFP expression and Western blot analysis

[0047] Use upstream primers 5′-GC with restriction enzyme sites BamHI and SalI (underlined) respectively GGATCC ATGAGCTCAGAGCAACACGAAAACGAAAGGCCTTCTGCTCCGCCCTTGTGTGCGAAGAACTGCGGCTT-3 (SEQ ID NO.5)' and downstream primer 5'-GC GTC GAC TCAAAGCTTCTGGAGTTTGTCTG-3' (SEQ ID NO. 6) was used to amplify the EtAN1-ZnFPORF sequence by PCR. The amplified fragment and the pGEX-4T-1 vector were digested with BamHI / SalI. The BamHI / SalI double-digested EtAN1-ZnFP fragment and the pGEX-4T-1 vector were recovered from agarose gel, and after ligation, the recombinant pGEX-4T-EtAN1-ZnFP plasmid was transformed into Escherichia coli BL21 (DE3) (Tiangen, China). Colonies with correct sequencing were expanded and cultured at 37°C, and 1.0 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) (Sigma, St Louis , MO, USA) induced expression for 8h. The cells were lysed by ultrasonication in an ice bath, ultrasonication was performed fo...

Embodiment 3

[0049] Example 3 Preparation of rEtAN1-ZnFP antiserum

[0050] 200 μg of purified rEtAN1-ZnFP was emulsified with an equal volume of complete Freund's adjuvant (Sigma, St Louis, MO, USA) and injected subcutaneously into 2-month-old New Zealand white rabbits. Two weeks later, booster immunization was carried out, which was emulsified with Freund's incomplete adjuvant (Sigma, St Louis, MO, USA). Immunizations were performed every 7 days for a total of 5 immunizations. Seven days after the last immunization, blood was collected and polyclonal antibody serum was separated. Negative serum was isolated from blood collected from rabbit ear vein before immunization.

[0051] Fluorescent quantitative PCR

[0052] In order to detect the transcription level of EtAN1-ZnFP in different developmental stages of Eimeria tenella (unsporulated oocysts, sporulated oocysts, sporozoites, and second-generation merozoites), the RNA of four stages was extracted and removed. After genomics, the fi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an eimeria tenella AN1-like Zinc finger domain-containing protein and an application thereof in inhibiting invasion of coccidium. The eimeria tenella AN1-like Zinc finger domain-containing protein is cloned, expressed and purified. The transcription level of EtAN1-ZnFP in different developmental stages of polypides is detected by fluorescence quantitative PCR (qPCR). The immune protective effect of EtAN1-ZnFP after chickens are infected with coccidium is evaluated by immunoprotection experiments. Research results indicate that the EtAN1-ZnFP is possible to participate ininvasion and growing development of eimeria tenella.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to an Eimeria tenella AN1-like zinc finger protein and its application in inhibiting coccidia invasion. Background technique [0002] The protozoan parasite Eimeria tenella is the main causative agent of coccidiosis in chickens, causing considerable economic losses to the chicken industry worldwide. At present, the prevention and control of coccidiosis mainly relies on drug treatment and immunoprophylaxis with live vaccines. However, Eimeria has developed resistance to most commercially available coccidiostats due to long-term and widespread use of various coccidiostats. In addition, the residues of these drugs have caused food safety problems, and there are problems such as loose poison and price of live anticoccidia vaccines. Although subunit vaccines are less effective than live vaccines, they are relatively easier to produce, more convenient and safer. The immune effe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/455C12N15/30C12N15/70C12N15/11C07K16/20C07K16/06C12Q1/6893A61P33/02
CPCC07K14/455C12N15/70C07K16/20C07K16/06C12Q1/6893A61P33/02
Inventor 董辉黄兵赵焕之朱顺海赵其平韩红玉李志行王璐刘桂玲
Owner SHANGHAI VETERINARY RES INST CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com