Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Cephalosporin C acylase mutant with one or any point mutations and preparation method thereof

A technology of acylase and mutants, which is applied in the field of drug production and can solve problems such as low enzyme activity, high impurities, and poor thermal stability

Active Publication Date: 2019-06-21
CSPC SHENGXUE GLUCOSE CO LTD
View PDF12 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In actual industrial applications, in order to reduce the formation of impurities in the reaction process, the reaction temperature should not exceed 25°C, generally maintained at 25 to 30°C, but at this time the enzyme activity is low, the by-products are still large, the impurities are high, and the enzyme stability is affected. The impact, the batch used will be reduced accordingly
Cephalosporin C acylase derived from Pseudomonas Sp.SE83 and Pseudomonas Sp.N176, as an AcyII class acylase, has poor thermal stability and large α subunit. Applications are very limited

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cephalosporin C acylase mutant with one or any point mutations and preparation method thereof
  • Cephalosporin C acylase mutant with one or any point mutations and preparation method thereof
  • Cephalosporin C acylase mutant with one or any point mutations and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025]Example 1 Construction of CPC Acylase Mutants

[0026] 1.1 Cloning of CPC acylase gene

[0027] The CPC acylase gene derived from Pseudomonas sp.130 (see SEQ ID NO.1, synthesized by GenScript) was synthesized from the whole gene, and the gene was cloned into the expression vector pUC57 to obtain the recombinant plasmid pUC57-CPCA. Use pUC57-CPCA as a template to amplify the target gene fragment. The DNA polymerase PrimeSTAR used in PCR and the corresponding buffer and dNTP solution were all purchased from Treasure Biotechnology Company. The primer sequence was synthesized by GenScript, and the primer sequence is: F: GGGAATTC CATATG CTGAGAGTTCTGCACCG (the underlined base is the NdeI recognition site) R: CCG GAATTC TCATGGCTTGAAGTTGAAGGG (underlined bases are EcoRI recognition sites)

[0028] PCR amplification reaction system: Sterilized water: 32.5 μL

[0029] 5×PrimeSTAR buffer (Mg 2+ Plus): 10 μL

[0030] dNTP solution (2.5mM each): 4μL

[0031] DNA polymerase ...

Embodiment 2

[0053] Embodiment 2 conversion reaction

[0054] 2.1 Transformation reactions catalyzed by mutant 1

[0055] Reaction conditions: CPC 1g / L, input enzyme activity 600-800U / L (immobilized enzyme or liquid enzyme), reaction temperature 25°C, result: reaction time 40-120min, conversion rate 98-99%.

[0056] 2.2 Transformation reactions catalyzed by mutant 2

[0057]Reaction conditions: CPC 1g / L, input enzyme activity 600-800U / L (immobilized enzyme or liquid enzyme), reaction temperature 14-25°C, result: reaction time 20-120min, conversion rate over 99%.

[0058] 2.3 Transformation reactions catalyzed by mutant 3

[0059] Reaction conditions: CPC 1g / L, input enzyme activity 600-800U / L (immobilized enzyme or liquid enzyme), reaction temperature 14-25°C, result: reaction time 20-120min, conversion rate over 99%.

[0060] 2.4 Transformation reactions catalyzed by mutant 4

[0061] Reaction conditions: CPC 1-5g / L, input enzyme activity 600-4000U / L (immobilized enzyme or liquid enzy...

Embodiment 3

[0072] Embodiment 3 impurity detection

[0073] Chromatographic column: phenomenex (Philomen) filler: Gemini 5um C18;

[0074] Mobile phase preparation:

[0075] Buffer: 1.54g NH 4 COOCH 3 →1000mL pH=6.0; buffer: acetonitrile=95:5 (1000mL buffer added 53mL acetonitrile); detection wavelength: 260nm column oven temperature: 25°C; flow rate: 1.2mL / min. Respectively D-CPC, D-7ACA, DO-CPC, DO-7ACA, CPC, 7-ACA in chronological order, using mutant 1-6 to react, impurity analysis is less than 0.3% ( image 3 , Mutant 6 reaction result), comparative example S12 impurity analysis is greater than 0.7%.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of production of medicine, in particular to production of cephalosporin antibiotics and a production enzyme therefor, more in particular to a cephalosporin C acylasemutant with one or any point mutations, nucleic acid to encode the mutant, a related expression vector and host cells, a preparation method of the mutant, and application of the mutant to prepare 7-ACA (7-aminocephalosporanic acid) through one-step lysis of CPC (cephalosporin).

Description

technical field [0001] The present invention relates to the field of pharmaceutical production, in particular to the production of cephalosporin antibiotics and enzymes for their production, more specifically, to cephalosporin C acylase mutants containing one or several point mutations, nucleic acids encoding them, and related expression vectors And the host cell, its preparation method and the use of the mutant for one-step cleavage of CPC to prepare 7-ACA. Background technique [0002] 7-ACA (7-aminocephalosporanic acid, 7-aminocephalosporanic acid) is a very important antibiotic synthetic intermediate, which can be used to synthesize a variety of cephalosporin antibiotics and has important medical value. In industry, the earliest chemical cracking method was used to crack cephalosporin C (Cephalosporin C, CPC) to prepare 7-ACA. Organic solvents can cause problems such as environmental pollution. Therefore, in recent years, enzymatic methods that are environmentally frie...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/80C12P35/02C12N15/55C12N15/70C12N1/21
Inventor 任丽梅朱科王翠韩卫强李红飞王明晓袁国强
Owner CSPC SHENGXUE GLUCOSE CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com