Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Genetically engineered bacterium producing malic acid and method for producing malic acid

A technology of malic acid and engineering bacteria, which is applied in the field of genetic engineering and biology, can solve the problems not involved in the production of malic acid, and achieve the effects of avoiding the use of neutralizing agents, improving expression or activity, and increasing production

Active Publication Date: 2019-05-24
SHANGHAI DONGGENG CHEM TECH CO LTD
View PDF1 Cites 17 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, currently Aspergillus niger is mainly focused on the production of citric acid and has not been involved in the production of malic acid

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genetically engineered bacterium producing malic acid and method for producing malic acid
  • Genetically engineered bacterium producing malic acid and method for producing malic acid
  • Genetically engineered bacterium producing malic acid and method for producing malic acid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Overexpression of the mae gene in Myceliophthora thermophila

[0042] 1. Construction and transformation of overexpressed dibasic acid transporter vector

[0043] Binary amplified from Aspergillus oryzae cDNA using primers Mae-F (SEQ ID NO. 13: 5'-aatggttaacATGCTGACACCCTCCCAAG-3') and primers Mae-R (SEQ ID NO. The coding reading frame of the acid transporter gene (mae gene for short), the PCR reaction system is: 2×Rapid Taq Master Mix 25 μL, Mae-F 1 μL, Mae-R 1 μL, cDNA 1 μL, water 22 μL. The PCR reaction conditions were: 95°C for 3 min; 30 cycles of 95°C for 15 s, 58°C for 15 s, 72°C for 1.5 min; 72°C for 5 min, 4°C for 5 min. After the completion of the PCR reaction, use the restriction endonuclease Hpa I to digest the PCR product and insert it into the EcoR V site of the plasmid pGL01 (plasmid map as shown in figure 1 Shown), the plasmid pGLO1-mae was obtained.

[0044] 2. Myceliophthora thermophila protoplast transformation method

[0045] The protoplast transfo...

Embodiment 2

[0052] Knockout of Methyltransferase laeA Gene in Recombinant Myceliophthora thermophila

[0053] 1. Construction of Myceliophthora thermophila methyltransferase laeA gene knockout vector

[0054] According to the whole genome information of Myceliophthora thermophila, primers were designed to amplify the upstream and downstream homologous fragments of the methyltransferase laeA gene (MYCTH_2294559). The primers were designed as follows:

[0055] laeA-MFF (SEQ ID NO. 15): TTCGAGATCTAACCCATCATCTCGGTCCTCTA;

[0056] laeA-MFR (SEQ ID NO. 16): TTCGAGATCTAGCTTCAAATCGCGTGTTTCAT;

[0057] laeA-MRF (SEQ ID NO. 17): TTCGACTAGTGGCAAGCCCTCCAGCCACTT;

[0058] laeA-MRR (SEQ ID NO. 18): TTCGACTAGTTTCCTGGGCAGCAGCGGAGT;

[0059] laeA-F (SEQ ID NO. 19): AATCGCACCCTACCAAGAAGT;

[0060] laeA-R (SEQ ID NO. 20): ATGGTCAGTCAGCAGTGTTT.

[0061] Using the genome as a template, carry out PCR amplification, amplify the upstream homologous fragments with primers laeA-MFF and laeA-MFR, amplify the d...

Embodiment 3

[0069] Knockout of methyltransferase laeA and overexpression of dibasic acid transporter in Aspergillus niger

[0070] 1. Construction of Aspergillus niger methyltransferase AnlaeA gene knockout vector

[0071] According to the whole genome information of Aspergillus niger (Netherlands Microorganism Culture Collection Center, CBS513.88), primers were designed to amplify the upstream and downstream homologous fragments of the methyltransferase laeA gene (Aspni7︱170198). The primers were designed as follows:

[0072] laeA-AFF (SEQ ID NO. 21): ttcgagatctTTTCCCACCATTCCAGCCCT;

[0073] laeA-AFR (SEQ ID NO. 22): ttcgagatctATCGTTGTTGTCCGGGGGTT;

[0074] laeA-ARF (SEQ ID NO. 23): ttcgactagtTGAGCAGAAGGTAGCCCGTT;

[0075] laeA-ARR (SEQ ID NO. 24): ttcgactagtGAGGGTTCTTGGCGTCTGGT.

[0076] Using the genome as a template, carry out PCR amplification, use primers laeA-AFF and laeA-AFR to amplify to obtain upstream homologous fragments, and use primers laeA-ARF and laeA-ARR to amplify to ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a genetically engineered bacterium producing malic acid and a method for producing the malic acid. The genetically engineered bacterium is obtained by increasing the expressionor activity of diacid transporter in the recipient bacterium and decreasing the expression or activity of methyltransferase laeA in the recipient bacterium. By the arrangement, the yield of the malicacid is effectively increased, furthermore, use of a neutralizer is effectively avoided by introducing the acid-resistant engineered bacterium.

Description

technical field [0001] The present invention relates to the fields of genetic engineering and biotechnology, in particular to a method and application for constructing a malic acid production strain by means of genetic engineering and increasing the yield of malic acid, and further relates to the construction and application of an acid-resistant high-yield malic acid production strain. Background technique [0002] The production of bulk chemicals by biological methods is one of the effective ways for the green and sustainable development of my country's economy and to get rid of oil dependence. Malic acid is a very important bulk chemical product. As early as 2004, it was identified as one of the 12 most competitive platform compounds by the U.S. Department of Energy. It is widely used in food, beverages, spices, medicine and health care, chemicals, plastics and other industries. At present, the demand in the international market keeps growing rapidly, and the market prosp...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/15C12N15/31C12N9/10C12N15/54C12P7/46C12R1/645C12R1/685C12R1/69C12R1/66
CPCY02E50/10
Inventor 唐曦李有发王家凤栗元龙康小玲
Owner SHANGHAI DONGGENG CHEM TECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com